GEO Profiles Links for Nucleotide (Select 26098250) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 13

Select item 44865131.

Vcpip1 - Zygotic gene activation

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 17413 (ID_REF), GDS579, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, K0617A05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4486513

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76141282.

Vcpip1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCAAAGCAAGATTTTT (ID_REF), GDS878, AK079052

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7614128

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44632133.

Vcpip1 - Preimplantation development

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 17413 (ID_REF), GDS578, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, K0617A05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4463213

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44707384.

Vcpip1 - Zygotic gene activation

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 1638 (ID_REF), GDS579, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, C0237C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4470738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44616125.

Vcpip1 - Preimplantation development

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 15812 (ID_REF), GDS578, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, K0247B07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4461612

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74764286.

Vcpip1 - MPSS transcriptome analysis project

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCAAAGCAAGATTTTT (ID_REF), GDS868, AK079052

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7476428

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 44474387.

Vcpip1 - Preimplantation development

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 1638 (ID_REF), GDS578, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, C0237C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4447438

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44849128.

Vcpip1 - Zygotic gene activation

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 15812 (ID_REF), GDS579, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, K0247B07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4484912

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61521129.

Vcpip1 - Blastocyst dormancy and activation comparison

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 15812 (ID_REF), GDS752, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, K0247B07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6152112

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 613793810.

Vcpip1 - Blastocyst dormancy and activation comparison

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 1638 (ID_REF), GDS752, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, C0237C07-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6137938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615371311.

Vcpip1 - Blastocyst dormancy and activation comparison

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL870, 17413 (ID_REF), GDS752, AK017812, AK030104, AK031402, AK031819, AK077494, AK079052, AK122563, BC006059, BC052908, BC059209, K0617A05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6153713

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3031358112.

Vcpip1 - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22817_at (ID_REF), GDS2327, 9330106H21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30313581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 464708113.

Vcpip1 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Vcpip1, valosin containing protein (p97)/p47 complex interacting protein 1

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m22817_at (ID_REF), GDS592, 9330106H21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4647081

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26098250) (13)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 13

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity