GEO Profiles Links for Nucleotide (Select 26097475) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 20

Select item 978648411.

Palld - Atherosclerosis susceptibility model: macrophages

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL9734, 100100658_TGI_at (ID_REF), GDS4527, AK077756

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97864841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971518412.

Palld - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL9734, 100100658_TGI_at (ID_REF), GDS4495, AK077756

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97151841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644714413.

Palld - Hypertension model: kidney

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL9734, 100100658_TGI_at (ID_REF), GDS3675, AK077756

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64471441

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644318414.

Palld - Hypertension model: liver

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL9734, 100100658_TGI_at (ID_REF), GDS3674, AK077756

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64431841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643922415.

Palld - Hypertension model: heart

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL9734, 100100658_TGI_at (ID_REF), GDS3673, AK077756

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64392241

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643526416.

Palld - Hypertension model: aorta

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL9734, 100100658_TGI_at (ID_REF), GDS3672, AK077756

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64352641

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76698037.

Palld - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL1010, GATCCATTTAGGTGAAACAT (ID_REF), GDS878, AK077756

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7669803

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75321038.

Palld - MPSS transcriptome analysis project

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL1010, GATCCATTTAGGTGAAACAT (ID_REF), GDS868, AK077756

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7532103

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61567429.

Palld - Blastocyst dormancy and activation comparison

Annotation:: Palld, palladin, cytoskeletal associated protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 20442 (ID_REF), GDS752, AK002935, AK013509, AK047891, BC010197, U23184, AK077756, L0547D10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6156742

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 614715210.

Palld - Blastocyst dormancy and activation comparison

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL870, 10852 (ID_REF), GDS752, AF205078, AF205079, AK010350, AK031696, AK052489, AK076423, AK077756, AK079524, H3104E03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6147152

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614664711.

Palld - Blastocyst dormancy and activation comparison

Annotation:: Palld, palladin, cytoskeletal associated protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 10347 (ID_REF), GDS752, AK005090, AK005441, AK010570, AK033099, AK045059, AK077756, H3094E10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6146647

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 614566812.

Klhl2 - Blastocyst dormancy and activation comparison

Annotation:: Klhl2, kelch-like 2, Mayven (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9368 (ID_REF), GDS752, AK020050, AK032116, AK079387, BC024572, BC031142, AK077756, H3080C02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6145668

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 448954213.

Palld - Zygotic gene activation

Annotation:: Palld, palladin, cytoskeletal associated protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 20442 (ID_REF), GDS579, AK002935, AK013509, AK047891, BC010197, U23184, AK077756, L0547D10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4489542

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 447995214.

Palld - Zygotic gene activation

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL870, 10852 (ID_REF), GDS579, AF205078, AF205079, AK010350, AK031696, AK052489, AK076423, AK077756, AK079524, H3104E03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4479952

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447944715.

Palld - Zygotic gene activation

Annotation:: Palld, palladin, cytoskeletal associated protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 10347 (ID_REF), GDS579, AK005090, AK005441, AK010570, AK033099, AK045059, AK077756, H3094E10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4479447

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 447846816.

Klhl2 - Zygotic gene activation

Annotation:: Klhl2, kelch-like 2, Mayven (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9368 (ID_REF), GDS579, AK020050, AK032116, AK079387, BC024572, BC031142, AK077756, H3080C02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4478468

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 446624217.

Palld - Preimplantation development

Annotation:: Palld, palladin, cytoskeletal associated protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 20442 (ID_REF), GDS578, AK002935, AK013509, AK047891, BC010197, U23184, AK077756, L0547D10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4466242

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445665218.

Palld - Preimplantation development

Annotation:: Palld, palladin, cytoskeletal associated protein

Organism:: Mus musculus

Reporter:: GPL870, 10852 (ID_REF), GDS578, AF205078, AF205079, AK010350, AK031696, AK052489, AK076423, AK077756, AK079524, H3104E03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4456652

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445614719.

Palld - Preimplantation development

Annotation:: Palld, palladin, cytoskeletal associated protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 10347 (ID_REF), GDS578, AK005090, AK005441, AK010570, AK033099, AK045059, AK077756, H3094E10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4456147

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445516820.

Klhl2 - Preimplantation development

Annotation:: Klhl2, kelch-like 2, Mayven (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9368 (ID_REF), GDS578, AK020050, AK032116, AK079387, BC024572, BC031142, AK077756, H3080C02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4455168

GEO DataSets Gene Profile neighbors Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26097475) (20)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 20

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity