GEO Profiles Links for Nucleotide (Select 26087688) - GEO Profiles - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 5

Select item 74951901.

Value/Rank Plot

MPSS transcriptome analysis project

Annotation:: Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430077D06 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAGATAACCAGCAGT (ID_REF), GDS868, AK040204

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7495190

Select item 413958692.

Value/Rank Plot

Nephronophthisis model

Annotation:: Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430077D06 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL2897, 26069 (ID_REF), GDS2817, AK040204

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41395869

GEO DataSets Profile neighbors

Select item 187682693.

Value/Rank Plot

MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430077D06 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL2897, 26069 (ID_REF), GDS1729, AK040204

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18768269

GEO DataSets Profile neighbors

Select item 76328904.

Value/Rank Plot

MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430077D06 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGAGATAACCAGCAGT (ID_REF), GDS878, AK040204

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7632890

Select item 467998355.

Value/Rank Plot

Dicer inactivation effect on the embryonic heart

Annotation:: Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430077D06 product:unclassifiable, full insert sequence

Organism:: Mus musculus

Reporter:: GPL5025, 2335 (ID_REF), GDS3033, AK040204

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46799835

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26087688) (5)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles