GEO Profiles Links for Nucleotide (Select 26082874) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 11

Select item 44485681.

Abhd13 - Preimplantation development

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL870, 2768 (ID_REF), GDS578, AK004375, AK032495, AK040929, C0400G03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4448568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44642892.

Abhd13 - Preimplantation development

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL870, 18489 (ID_REF), GDS578, AK004375, AK032495, AK040929, L0209H11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4464289

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 187718793.

Abhd13 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL2897, 58095 (ID_REF), GDS1729, AK032495

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18771879

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 413994794.

Abhd13 - Nephronophthisis model

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL2897, 58095 (ID_REF), GDS2817, AK032495

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41399479

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75202915.

Abhd13 - MPSS transcriptome analysis project

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCATGGTTCTGGTAACAT (ID_REF), GDS868, AK032495

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7520291

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 468025826.

Abhd13 - Dicer inactivation effect on the embryonic heart

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL5025, 5082 (ID_REF), GDS3033, AK032495

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46802582

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44718687.

Abhd13 - Zygotic gene activation

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL870, 2768 (ID_REF), GDS579, AK004375, AK032495, AK040929, C0400G03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4471868

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61547898.

Abhd13 - Blastocyst dormancy and activation comparison

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL870, 18489 (ID_REF), GDS752, AK004375, AK032495, AK040929, L0209H11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6154789

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44875899.

Abhd13 - Zygotic gene activation

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL870, 18489 (ID_REF), GDS579, AK004375, AK032495, AK040929, L0209H11-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4487589

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 613906810.

Abhd13 - Blastocyst dormancy and activation comparison

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL870, 2768 (ID_REF), GDS752, AK004375, AK032495, AK040929, C0400G03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6139068

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 765799111.

Abhd13 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Abhd13, abhydrolase domain containing 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCATGGTTCTGGTAACAT (ID_REF), GDS878, AK032495

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7657991

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26082874) (11)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 11

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity