GEO Profiles Links for Nucleotide (Select 236466497) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 285

<< First< Prev

Page of 15

Next >Last >>

Select item 824769641.

Uggt1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2417316 (ID_REF), GDS3720, NM_198899

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82476964

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441705172.

Uggt1 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL891, 4817 (ID_REF), GDS2924, NM_198899, A_51_P148838 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44170517

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 793467363.

Uggt1 - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS4115, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79346736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1300028404.

Uggt1 - Lymphotoxin-β receptor agonist antibody effect on lipopolysaccharide-stimulated embryonic fibroblasts

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2417316 (ID_REF), GDS5655, NM_198899

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 130002840

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 793834365.

Uggt1 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS4116, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79383436

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 794435366.

Uggt1 - Model for inflammatory signaling in prostate epithelium based on expression of a constitutively active version of IκB kinase 2 (IKK2ca)

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS4119, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 79443536

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 619936767.

Uggt1 - Eset depletion effect on embryonic stem cell

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6333, scl00320011.1_153-S (ID_REF), GDS3599, NM_198899, Ugcgl1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61993676

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596515648.

Uggt1 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2417316 (ID_REF), GDS3522, NM_198899

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59651564

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1114247409.

Uggt1 - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2417316 (ID_REF), GDS5066, NM_198899

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111424740

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12571624010.

Uggt1 - Receptor activator of NF-κB ligand effect on bone marrow-derived macrophage cells: time course

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2417316 (ID_REF), GDS5422, NM_198899

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125716240

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1301201711.

Uggt1 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL891, 4817 (ID_REF), GDS1360, NM_198899, A_51_P148838 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13012017

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11939045512.

Uggt1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P236775 (ID_REF), GDS5258, NM_198899, A_51_P236775 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119390455

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2495021713.

Uggt1 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL891, 4817 (ID_REF), GDS2078, NM_198899, A_51_P148838 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24950217

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7554003614.

Uggt1 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS3999, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75540036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1877822115.

Uggt1 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL2897, 115053 (ID_REF), GDS1729, NM_198899

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18778221

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10808243616.

Uggt1 - Prostate cancer cell line response to overexpression of Twist1 and Twist1 mutants

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS4955, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 108082436

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6259407617.

Uggt1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6333, scl00320011.1_153-S (ID_REF), GDS3621, NM_198899, Ugcgl1 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62594076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7508923618.

Uggt1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS3987, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75089236

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10846153619.

Uggt1 - Pyrazinamide effect on pulmonary tuberculosis model : time course

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10353803 (ID_REF), GDS4967, NM_198899, AK087883, BC062936, BC068283, BC051172, chr1:36051895-36244276 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108461536

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766884220.

Uggt1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Uggt1, UDP-glucose glycoprotein glucosyltransferase 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTTGGGGCTAAGGCTC (ID_REF), GDS878, NM_198899

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7668842

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 236466497) (285)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 285

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity