GEO Profiles Links for Nucleotide (Select 20072592) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 17

Select item 978551691.

Anln - Atherosclerosis susceptibility model: macrophages

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL9734, 100105127_TGI_at (ID_REF), GDS4527, BC027141

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97855169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971421692.

Anln - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL9734, 100105127_TGI_at (ID_REF), GDS4495, BC027141

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97142169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644617693.

Anln - Hypertension model: kidney

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL9734, 100105127_TGI_at (ID_REF), GDS3675, BC027141

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64461769

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644221694.

Anln - Hypertension model: liver

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL9734, 100105127_TGI_at (ID_REF), GDS3674, BC027141

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64422169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643825695.

Anln - Hypertension model: heart

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL9734, 100105127_TGI_at (ID_REF), GDS3673, BC027141

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64382569

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643429696.

Anln - Hypertension model: aorta

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL9734, 100105127_TGI_at (ID_REF), GDS3672, BC027141

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64342969

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76465987.

Anln - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCACAGATGATGTATC (ID_REF), GDS878, BC027141

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7646598

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75088988.

Anln - MPSS transcriptome analysis project

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCACAGATGATGTATC (ID_REF), GDS868, BC027141

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7508898

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 61453709.

Anln - Blastocyst dormancy and activation comparison

Annotation:: Anln, anillin, actin binding protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9070 (ID_REF), GDS752, AF260557, AF306667, AJ277486, AK052155, BC027141, H3076A12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6145370

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 614227110.

Anln - Blastocyst dormancy and activation comparison

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL870, 5971 (ID_REF), GDS752, AK004134, AK013624, AK046102, BC027141, BC030489, BC032164, BZ690761, CL210545, H3014B01-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6142271

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 613804911.

Anln - Blastocyst dormancy and activation comparison

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL870, 1749 (ID_REF), GDS752, AK004134, AK013624, AK046102, BC027141, BC030489, BC032164, BZ690761, CL210545, C0249A10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6138049

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447817012.

Anln - Zygotic gene activation

Annotation:: Anln, anillin, actin binding protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9070 (ID_REF), GDS579, AF260557, AF306667, AJ277486, AK052155, BC027141, H3076A12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4478170

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 447507113.

Anln - Zygotic gene activation

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL870, 5971 (ID_REF), GDS579, AK004134, AK013624, AK046102, BC027141, BC030489, BC032164, BZ690761, CL210545, H3014B01-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4475071

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447084914.

Anln - Zygotic gene activation

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL870, 1749 (ID_REF), GDS579, AK004134, AK013624, AK046102, BC027141, BC030489, BC032164, BZ690761, CL210545, C0249A10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4470849

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445487015.

Anln - Preimplantation development

Annotation:: Anln, anillin, actin binding protein (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 9070 (ID_REF), GDS578, AF260557, AF306667, AJ277486, AK052155, BC027141, H3076A12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4454870

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445177116.

Anln - Preimplantation development

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL870, 5971 (ID_REF), GDS578, AK004134, AK013624, AK046102, BC027141, BC030489, BC032164, BZ690761, CL210545, H3014B01-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4451771

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 444754917.

Anln - Preimplantation development

Annotation:: Anln, anillin, actin binding protein

Organism:: Mus musculus

Reporter:: GPL870, 1749 (ID_REF), GDS578, AK004134, AK013624, AK046102, BC027141, BC030489, BC032164, BZ690761, CL210545, C0249A10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4447549

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 20072592) (17)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 17

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity