GEO Profiles Links for Nucleotide (Select 142370454) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 445

<< First< Prev

Page of 23

Next >Last >>

Select item 1304682491.

Cacng5 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P86353 (ID_REF), GDS5666, NM_080644, A_52_P86353 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130468249

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 921883992.

Cacng5 - 16p11.2 copy number variation models: various brain regions

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6246, 10392374 (ID_REF), GDS4430, NM_001199301, NM_080644, AF361347, AF458900, BC120894, BC120895, chr11:107874605-107915055 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 37 samples

ID:: 92188399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1276088873.

Cacng5 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2812240 (ID_REF), GDS5501, NM_080644

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127608887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 441791304.

Cacng5 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL891, 13430 (ID_REF), GDS2924, NM_080644, A_51_P188155 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44179130

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74792025.

Cacng5 - MPSS transcriptome analysis project

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGTCCACATTGTTCT (ID_REF), GDS868, NM_080644

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7479202

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 616256636.

Cacng5 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2812240 (ID_REF), GDS3582, NM_080644, CACNG5 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61625663

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159433637.

Cacng5 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2812240 (ID_REF), GDS5157, NM_080644, CACNG5 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115943363

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249588308.

Cacng5 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL891, 13430 (ID_REF), GDS2078, NM_080644, A_51_P188155 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24958830

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1213102879.

Cacng5 - Restless Legs Syndrome model: adult whole brain

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2812240 (ID_REF), GDS5299, NM_080644

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121310287

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12760888910.

Cacng5 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2725698 (ID_REF), GDS5501, NM_080644

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127608889

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7567623911.

Cacng5 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6481, 2030673 (ID_REF), GDS4002, NM_080644, Cacng5 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75676239

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8248857912.

Cacng5 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2725698 (ID_REF), GDS3720, NM_080644

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82488579

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11291079213.

Cacng5 - P81S von Hippel-Lindau mutation effect on embryonic stem cell teratomas

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL11533, 10392374 (ID_REF), GDS4865, NM_080644, BC120895, chr11:107735919-107776369 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 112910792

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11885104914.

Cacng5 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P86353 (ID_REF), GDS5241, NM_080644, A_52_P86353 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118851049

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9179937115.

Cacng5 - Oxidative stress effect on ATF4 knockout embryonic neurons

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6100, 2030673 (ID_REF), GDS3311, NM_080644

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 91799371

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7318158816.

Cacng5 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1226821 (ID_REF), GDS3932, NM_080644

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73181588

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6802439717.

Cacng5 - Snord116del mutant hypothalamus response to neonatal starvation

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2725698 (ID_REF), GDS3786, NM_080644

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 68024397

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7192918718.

Cacng5 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2812240 (ID_REF), GDS3900, NM_080644

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71929187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6256860219.

Cacng5 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6333, scl39410.8_331-S (ID_REF), GDS3621, NM_080644, Cacng5 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62568602

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10884689920.

Cacng5 - Light-induced retinal damage

Annotation:: Cacng5, calcium channel, voltage-dependent, gamma subunit 5

Organism:: Mus musculus

Reporter:: GPL6246, 10392374 (ID_REF), GDS4980, NM_001199301, NM_080644, AF361347, AF458900, BC120894, BC120895, chr11:107874605-107915055 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108846899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 23

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 142370454) (445)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 445

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity