GEO Profiles Links for Nucleotide (Select 12856818) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 41

<< First< Prev

Page of 3

Next >Last >>

Select item 327359391.

Thg1l - Prostate cancer progression model: stromal cell

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4371, 12539 (ID_REF), GDS2443, AK017532

DataSet type:: Expression profiling by array, log2 ratio, 10 samples

ID:: 32735939

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76548072.

Thg1l - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTATTGGGGATGCCTT (ID_REF), GDS878, AK017532

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7654807

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75171073.

Thg1l - MPSS transcriptome analysis project

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTATTGGGGATGCCTT (ID_REF), GDS868, AK017532

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7517107

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 61479944.

Thg1l - Blastocyst dormancy and activation comparison

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL870, 11694 (ID_REF), GDS752, AK007233, AK010876, AK015467, AK016076, AK017532, CL214687, H3121F02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6147994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44807945.

Thg1l - Zygotic gene activation

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL870, 11694 (ID_REF), GDS579, AK007233, AK010876, AK015467, AK016076, AK017532, CL214687, H3121F02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4480794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44574946.

Thg1l - Preimplantation development

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL870, 11694 (ID_REF), GDS578, AK007233, AK010876, AK015467, AK016076, AK017532, CL214687, H3121F02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4457494

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 22191387.

Thg1l - Ligand screen in B cells: untreated

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS323, AK017532

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2219138

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 22023388.

Thg1l - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS322, AK017532

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2202338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 21855389.

Thg1l - Ligand screen in B cells: transforming growth factor-beta

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS321, AK017532

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2185538

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 216873810.

Thg1l - Ligand screen in B cells: terbutaline

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS320, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2168738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215193811.

Thg1l - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS319, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2151938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 213513812.

Thg1l - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS318, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2135138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211833813.

Thg1l - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS317, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2118338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 210153814.

Thg1l - Ligand screen in B cells: prostaglandin E2

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS316, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2101538

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 208473815.

Thg1l - Ligand screen in B cells: platelet activating factor

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS315, AK017532

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2084738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206793816.

Thg1l - Ligand screen in B cells: neuropeptide Y

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS314, AK017532

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2067938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 205113817.

Thg1l - Ligand screen in B cells: nerve growth factor

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS313, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2051138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 203433818.

Thg1l - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS312, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2034338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201753819.

Thg1l - Ligand screen in B cells: leukotriene B4

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS311, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2017538

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 200073820.

Thg1l - Ligand screen in B cells: lipopolysaccharide

Annotation:: Thg1l, tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL260, 17605 (ID_REF), GDS310, AK017532

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2000738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12856818) (41)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 41

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity