GEO Profile Links for Gene (Select 77083) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 49

<< First< Prev

Page of 3

Next >Last >>

Select item 978647631.

3010023C09Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100095588_TGI_at (ID_REF), GDS4527, AK019385

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97864763

GEO DataSets Gene Profile neighbors

Select item 971517632.

3010023C09Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100095588_TGI_at (ID_REF), GDS4495, AK019385

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97151763

GEO DataSets Gene Profile neighbors

Select item 716823703.

3010023C09Rik - Fasting effect on multiple tissues: time course

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL11012, 16870 (ID_REF), GDS3893, AK019385

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682370

GEO DataSets Gene Profile neighbors

Select item 644713634.

3010023C09Rik - Hypertension model: kidney

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100095588_TGI_at (ID_REF), GDS3675, AK019385

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64471363

GEO DataSets Gene Profile neighbors

Select item 644317635.

3010023C09Rik - Hypertension model: liver

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100095588_TGI_at (ID_REF), GDS3674, AK019385

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64431763

GEO DataSets Gene Profile neighbors

Select item 643921636.

3010023C09Rik - Hypertension model: heart

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100095588_TGI_at (ID_REF), GDS3673, AK019385

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64392163

GEO DataSets Gene Profile neighbors

Select item 643525637.

3010023C09Rik - Hypertension model: aorta

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100095588_TGI_at (ID_REF), GDS3672, AK019385

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64352563

GEO DataSets Gene Profile neighbors

Select item 625558348.

3010023C09Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl4687.1.1_1-S (ID_REF), GDS3621, 3010023C09Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62555834

GEO DataSets Gene Profile neighbors

Select item 619554349.

3010023C09Rik - Eset depletion effect on embryonic stem cell

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl4687.1.1_1-S (ID_REF), GDS3599, 3010023C09Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61955434

GEO DataSets Gene Profile neighbors

Select item 4996017210.

3010023C09Rik - Hepatocyte growth factor effect on Met receptor-knockout primary hepatocytes: time course

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL1536, 1226047_1 (ID_REF), GDS3148, AK019385

DataSet type:: Expression profiling by array, log2 ratio, 60 samples

ID:: 49960172

GEO DataSets Gene Profile neighbors

Select item 2159463511.

3010023C09Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL1942, 44635 (ID_REF), GDS1882, AK019385

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21594635

GEO DataSets Gene Profile neighbors

Select item 2159463412.

3010023C09Rik - Embryonic fibroblast-independent embryonic stem cell differentiation

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL1942, 44634 (ID_REF), GDS1882, AK019385

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 21594634

GEO DataSets Gene Profile neighbors

Select item 765451613.

3010023C09Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCGGGTACAGAGTCT (ID_REF), GDS878, AK019385

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7654516

GEO DataSets Gene

Select item 751681614.

3010023C09Rik - MPSS transcriptome analysis project

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCGGGTACAGAGTCT (ID_REF), GDS868, AK019385

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7516816

GEO DataSets Gene

Select item 221587915.

3010023C09Rik - Ligand screen in B cells: untreated

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL260, 13780 (ID_REF), GDS323, AK019385

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2215879

GEO DataSets Gene

Select item 219907916.

3010023C09Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL260, 13780 (ID_REF), GDS322, AK019385

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2199079

GEO DataSets Gene Profile neighbors

Select item 218227917.

3010023C09Rik - Ligand screen in B cells: transforming growth factor-beta

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL260, 13780 (ID_REF), GDS321, AK019385

DataSet type:: Expression profiling by array, log ratio, 9 samples

ID:: 2182279

GEO DataSets Gene Profile neighbors

Select item 216547918.

3010023C09Rik - Ligand screen in B cells: terbutaline

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL260, 13780 (ID_REF), GDS320, AK019385

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2165479

GEO DataSets Gene Profile neighbors

Select item 214867919.

3010023C09Rik - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL260, 13780 (ID_REF), GDS319, AK019385

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2148679

GEO DataSets Gene Profile neighbors

Select item 213187920.

3010023C09Rik - Ligand screen in B cells: stromal cell derived factor-1

Annotation:: 3010023C09Rik, RIKEN cDNA 3010023C09 gene

Organism:: Mus musculus

Reporter:: GPL260, 13780 (ID_REF), GDS318, AK019385

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2131879

GEO DataSets Gene Profile neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77083) (49)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 49

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity