GEO Profile Links for Gene (Select 56177) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 217790901.

Olfm1 - Strains exhibiting low or high freezing in response to fear: amygdala and hippocampus

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425784_a_at (ID_REF), GDS1901, 56177 (Gene ID), D78264

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 21779090

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 439774682.

Olfm1 - Various brain regions of several inbred strains

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426562_a_at (ID_REF), GDS2917, 56177 (Gene ID), BE952082

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43977468

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1191346683.

Olfm1 - Striatal-enriched protein tyrosine phosphatase (STEP) knockout effect on striatum

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426562_a_at (ID_REF), GDS5250, 56177 (Gene ID), BE952082

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 119134668

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1191338904.

Olfm1 - Striatal-enriched protein tyrosine phosphatase (STEP) knockout effect on striatum

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425784_a_at (ID_REF), GDS5250, 56177 (Gene ID), D78264

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 119133890

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756567255.

Olfm1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6481, 105080593 (ID_REF), GDS4002, D78265

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75656725

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756592936.

Olfm1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6481, 5570066 (ID_REF), GDS4002, NM_019498, Olfm1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75659293

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 454435687.

Olfm1 - Vitamin E supplementation effect on aged brain

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426562_a_at (ID_REF), GDS2973, 56177 (Gene ID), BE952082

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45443568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 192660578.

Olfm1 - CAG repeat knock-in model of spinocerebellar ataxia type 1 progression

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL339, 1426562_a_at (ID_REF), GDS1756, 56177 (Gene ID), BE952082

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 19266057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625967939.

Olfm1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6333, scl0003187.1_40-S (ID_REF), GDS3621, D78265

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62596793

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1992029110.

Olfm1 - Homeodomain interacting protein kinase 2 dominant-negative form effect on trigeminal ganglion

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1455796_x_at (ID_REF), GDS1793, 56177 (Gene ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 19920291

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4107076811.

Olfm1 - Fluoxetine effect on the hippocampus

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426562_a_at (ID_REF), GDS2803, 56177 (Gene ID), BE952082

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 41070768

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11594825612.

Olfm1 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1241371 (ID_REF), GDS5157, NM_001038614, OLFM1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115948256

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11592481113.

Olfm1 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3091574 (ID_REF), GDS5157, NM_001038612, OLFM1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115924811

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6163055614.

Olfm1 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1241371 (ID_REF), GDS3582, NM_001038614, OLFM1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61630556

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2177986815.

Olfm1 - Strains exhibiting low or high freezing in response to fear: amygdala and hippocampus

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426562_a_at (ID_REF), GDS1901, 56177 (Gene ID), BE952082

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 21779868

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6160711116.

Olfm1 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3091574 (ID_REF), GDS3582, NM_001038612, OLFM1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61607111

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6160503517.

Olfm1 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1240615 (ID_REF), GDS3582, NM_019498, OLFM1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61605035

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2211309018.

Olfm1 - Inhibitor-1 knockout effect on the hippocampus

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425784_a_at (ID_REF), GDS1920, 56177 (Gene ID), D78264

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22113090

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753153819.

Olfm1 - MPSS transcriptome analysis project

Annotation:: Olfm1, Olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCCTTTTGCATGCGA (ID_REF), GDS868, AI834968

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531538

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12164749120.

Olfm1 - Antidepressant fluoxetine effect on depression model: ventral dentate gyrus

Annotation:: Olfm1, olfactomedin 1

Organism:: Mus musculus

Reporter:: GPL1261, 1455796_x_at (ID_REF), GDS5308, 56177 (Gene ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 121647491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 56177) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity