GEO Profile Links for Gene (Select 382913) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 287

<< First< Prev

Page of 15

Next >Last >>

Select item 1225916191.

Neil2 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2613131 (ID_REF), GDS5341, NM_201610

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122591619

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1304609832.

Neil2 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P498396 (ID_REF), GDS5666, NM_201610, A_52_P498396 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130460983

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529730363.

Neil2 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL2872, 26636 (ID_REF), GDS3259, NM_201610, A_52_P498396 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52973036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092462644.

Neil2 - Diabetic db/db heart response to rosiglitazone

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL4134, 36364 (ID_REF), GDS4990, NM_201610, A_52_P498396 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109246264

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728508835.

Neil2 - Spatial and temporal development of mammalian salivary glands

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P498396 (ID_REF), GDS3922, NM_201610, A_52_P498396 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72850883

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1233466496.

Neil2 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2613131 (ID_REF), GDS5360, NM_201610, NEIL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123346649

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 840848627.

Neil2 - Chlamydia muridarum genital tract infection model: CD4 T cells

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6246, 10420736 (ID_REF), GDS4355, NM_201610, XM_006519202, AY518221, BC115762, XM_006519199, AK155596, chr14:63182443-63193541 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 84084862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 731801528.

Neil2 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2613131 (ID_REF), GDS3932, NM_201610

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73180152

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 653211979.

Neil2 - Addictive drugs effect on brain striatum: time course

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2613131 (ID_REF), GDS3703, NM_201610

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65321197

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7566778310.

Neil2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6481, 6100601 (ID_REF), GDS4002, NM_201610, Neil2 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75667783

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9784507511.

Neil2 - Atherosclerosis susceptibility model: macrophages

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL9734, 100082357_TGI_at (ID_REF), GDS4527, NM_201610

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97845075

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4143046912.

Neil2 - Nephronophthisis model

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL2897, 335061 (ID_REF), GDS2817, NM_201610

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41430469

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6198475613.

Neil2 - Eset depletion effect on embryonic stem cell

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6333, scl0382913.1_100-S (ID_REF), GDS3599, NM_201610, Neil2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61984756

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748072114.

Neil2 - MPSS transcriptome analysis project

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAGGATGAGGGCAAAG (ID_REF), GDS868, NM_201610

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7480721

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 10288516215.

Neil2 - Cardiomyocyte-specific Gata-4 or Gata-6 knockout effect on adult heart during pressure overload

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6246, 10420736 (ID_REF), GDS4782, NM_201610, XM_006519202, AY518221, BC115762, XM_006519199, AK155596, chr14:63182443-63193541 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 102885162

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6445167516.

Neil2 - Hypertension model: kidney

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL9734, 100082357_TGI_at (ID_REF), GDS3675, NM_201610

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64451675

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8260964917.

Neil2 - Effects of high-fat maternal diet and transcription factor Cited2 deficiency on embryos

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2613131 (ID_REF), GDS3724, NM_201610, NEIL2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 82609649

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10468946218.

Neil2 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6246, 10420736 (ID_REF), GDS4827, NM_201610, XM_006519202, AY518221, BC115762, XM_006519199, AK155596, chr14:63182443-63193541 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104689462

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12101634919.

Neil2 - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2613131 (ID_REF), GDS5293, NM_201610, NEIL2 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 121016349

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12336696220.

Neil2 - Normal mammary glands at three developmental stages: adipose stroma

Annotation:: Neil2, nei like 2 (E. coli)

Organism:: Mus musculus

Reporter:: GPL6246, 10420736 (ID_REF), GDS5361, NM_201610, XM_006519202, AY518221, BC115762, XM_006519199, AK155596, chr14:63182443-63193541 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123366962

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 382913) (287)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 287

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity