GEO Profile Links for Gene (Select 360213) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 420847601.

Trim46 - DNA electroporation effect on skeletal muscles: time course

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2840, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 42084760

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 368766602.

Trim46 - Multiple myeloma model

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2640, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 36876660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 413679603.

Trim46 - Morphine effect on the striatum

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2815, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 41367960

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 932390794.

Trim46 - Endothelial cells from P8 neonatal retina [MG_U74Bv2]

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL82, 113022_at (ID_REF), GDS4462, 360213 (Gene ID), AI845791

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93239079

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 286404605.

Trim46 - Adrenal gland in constant darkness: time course

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2232, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 28640460

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 54309796.

Trim46 - Down syndrome and brain (MG-U74B)

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL82, 113022_at (ID_REF), GDS682, 360213 (Gene ID), AI845791

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5430979

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824645667.

Trim46 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2499539 (ID_REF), GDS3720, NM_183037

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82464566

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 355133608.

Trim46 - Regenerating liver and developing embryonic liver comparison

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2577, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 35513360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 351375709.

Trim46 - Cdk7 complex subunit menage-a-trois 1 deficiency effect on hearts

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL81, 93716_at (ID_REF), GDS2561, 360213 (Gene ID), U16175

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 35137570

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1696887910.

Trim46 - Osteoblast differentiation (MG-U74B)

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL82, 113022_at (ID_REF), GDS1632, 360213 (Gene ID), AI845791

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16968879

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1522629611.

Trim46 - Transcription factor HNF4 null mutation effect on fetal colon

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL339, 1460568_at (ID_REF), GDS1507, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 15226296

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4131336012.

Trim46 - Brown and white adipose tissues

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2813, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41313360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 733517013.

Trim46 - Corneal stromal cell differentiation

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL81, 93716_at (ID_REF), GDS857, 360213 (Gene ID), U16175

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 7335170

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5323614.

Trim46 - Type 1 diabetes gene expression profiling

Annotation:: Trim46, Tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL24, 26236 (ID_REF), GDS10, AA139080

DataSet type:: Expression profiling by array, count, 28 samples

ID:: 53236

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2020796015.

Trim46 - Age effect on hematopoietic stem cells

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS1803, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20207960

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750563816.

Trim46 - MPSS transcriptome analysis project

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGCTGGGTTCCGGAG (ID_REF), GDS868, NM_017403

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7505638

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2036626017.

Trim46 - Graded HoxA10 expression effect on Lin(-) Sca1(+) c-kit(+) bone marrow cells

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS1809, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 20366260

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 293917118.

Trim46 - Heart failure and rescue (Mu11K-B)

Annotation:: Trim46, tripartite motif-containing 46 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL76, Msa.2059.0_at (ID_REF), GDS427, U16175

DataSet type:: Expression profiling by array, count, 53 samples

ID:: 2939171

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 3060186019.

Trim46 - Bed nucleus of the stria terminalis, nucleus accumbens, and dorsal striatum comparison

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL1261, 1460568_at (ID_REF), GDS2344, 360213 (Gene ID), BI156583

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 30601860

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5534987120.

Trim46 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Trim46, tripartite motif-containing 46

Organism:: Mus musculus

Reporter:: GPL5759, NM_001039466_at (ID_REF), GDS3385, NM_001039466

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55349871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 360213) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity