GEO Profile Links for Gene (Select 330677) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 62

<< First< Prev

Page of 4

Next >Last >>

Select item 129738531.

Nctc1 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1345, 4253 (ID_REF), GDS1357, BG795932

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12973853

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 75310572.

Nctc1 - MPSS transcriptome analysis project

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCAACCCTCTTAGGA (ID_REF), GDS868, AA062189

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531057

GEO DataSets Gene Chromosome neighbors

Select item 824536333.

Nctc1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2523613 (ID_REF), GDS3720, NR_002452

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82453633

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 46441604.

Nctc1 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m19896_a_at (ID_REF), GDS592, 9830166K08 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4644160

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1322146405.

Nctc1 - High-fat diet effect on brown adipose tissue development

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS6000, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132214640

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 75030726.

Nctc1 - MPSS transcriptome analysis project

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGGCTTGGGGCAGAA (ID_REF), GDS868, AK036720

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7503072

GEO DataSets Gene Chromosome neighbors

Select item 661923337.

Nctc1 - X chromosome dosage model

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2523613 (ID_REF), GDS3728, NR_002452

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66192333

GEO DataSets Gene Chromosome neighbors

Select item 1233182408.

Nctc1 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS5360, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123318240

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1210910409.

Nctc1 - Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS5295, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121091040

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1297402210.

Nctc1 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1345, 4422 (ID_REF), GDS1357, BG793683

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12974022

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6440535711.

Nctc1 - Hypertension model: liver

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL9734, 100107691_TGI_at (ID_REF), GDS3674, BG793683

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64405357

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12991974012.

Nctc1 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS5651, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129919740

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11590944013.

Nctc1 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS5157, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115909440

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1297528114.

Nctc1 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1345, 5681 (ID_REF), GDS1357, BG795037

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12975281

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 13268134015.

Nctc1 - Diet-induced obesity model: white adipose tissue

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS6247, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132681340

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11862114016.

Nctc1 - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2523613 (ID_REF), GDS5237, NR_002452, NCTC1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118621140

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 3031066017.

Nctc1 - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Nctc1, non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m19896_a_at (ID_REF), GDS2327, 9830166K08 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30310660

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6444495718.

Nctc1 - Hypertension model: kidney

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL9734, 100107691_TGI_at (ID_REF), GDS3675, BG793683

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64444957

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6440841919.

Nctc1 - Hypertension model: liver

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL9734, 100100191_TGI_at (ID_REF), GDS3674, BB120054

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64408419

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9783835720.

Nctc1 - Atherosclerosis susceptibility model: macrophages

Annotation:: Nctc1, Non-coding transcript 1

Organism:: Mus musculus

Reporter:: GPL9734, 100107691_TGI_at (ID_REF), GDS4527, BG793683

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97838357

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 4

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 330677) (62)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 62

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity