GEO Profile Links for Gene (Select 320662) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 523

<< First< Prev

Page of 27

Next >Last >>

Select item 529521311.

Casc1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL2872, 5731 (ID_REF), GDS3259, AK082677, A_52_P642074 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52952131

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1225818832.

Casc1 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2776534 (ID_REF), GDS5341, NM_177222

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122581883

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625687553.

Casc1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6333, scl00320662.1_330-S (ID_REF), GDS3621, NM_177222, Casc1 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62568755

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162759814.

Casc1 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2906549 (ID_REF), GDS5172, NM_177222, CASC1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116275981

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1092171305.

Casc1 - Diabetic db/db heart response to rosiglitazone

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL4134, 7230 (ID_REF), GDS4990, NM_177222, A_52_P149705 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109217130

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 481887136.

Casc1 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL4234, 5420132 (ID_REF), GDS3086, NM_177222

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48188713

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1225818847.

Casc1 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2603253 (ID_REF), GDS5341, NM_177222

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122581884

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162759838.

Casc1 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2906552 (ID_REF), GDS5172, NM_177222, CASC1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116275983

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162759829.

Casc1 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2603253 (ID_REF), GDS5172, NM_177222, CASC1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116275982

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13045024810.

Casc1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149705 (ID_REF), GDS5666, NM_177222, A_52_P149705 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130450248

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5179383111.

Casc1 - Interleukin-22 effect on colon cultures

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL2872, 5731 (ID_REF), GDS3226, AK082677, A_52_P642074 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51793831

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8962778912.

Casc1 - Lung epithelium response to fungal allergen Alternaria

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6246, 10549237 (ID_REF), GDS4423, NM_177222, XM_006506978, AK132912, AY423542, AY485607, AY485608, BC072568, BC120743, BC125423, chr6:145174926-145210970 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89627789

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13046171013.

Casc1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P523044 (ID_REF), GDS5666, AK082677, A_52_P523044 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130461710

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4559416514.

Casc1 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL4636, 12065 (ID_REF), GDS2976, NM_177222

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45594165

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7317221815.

Casc1 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2906552 (ID_REF), GDS3932, NM_177222

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73172218

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753310416.

Casc1 - MPSS transcriptome analysis project

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACAAGAGCGTCATCT (ID_REF), GDS868, NM_177222

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533104

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7565125617.

Casc1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6481, 6560685 (ID_REF), GDS4002, NM_177222, Casc1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75651256

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8247353718.

Casc1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2776534 (ID_REF), GDS3720, NM_177222

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82473537

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7284014819.

Casc1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P149705 (ID_REF), GDS3922, NM_177222, A_52_P149705 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72840148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11864058320.

Casc1 - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Casc1, cancer susceptibility candidate 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2906552 (ID_REF), GDS5237, NM_177222, CASC1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118640583

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 27

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320662) (523)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 523

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity