GEO Profile Links for Gene (Select 231602) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 956

<< First< Prev

Page of 48

Next >Last >>

Select item 420594181.

P2rx2 - DNA electroporation effect on skeletal muscles: time course

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS2840, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 42059418

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 354880182.

P2rx2 - Regenerating liver and developing embryonic liver comparison

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS2577, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 35488018

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 201826183.

P2rx2 - Age effect on hematopoietic stem cells

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS1803, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 20182618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 220196184.

P2rx2 - Hepatocyte nuclear factor 4 alpha knockout effect on the embryonic liver

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS1916, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22019618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 325966185.

P2rx2 - Limbal and central corneal epithelial basal cell comparison

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS2433, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 32596618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1173076276.

P2rx2 - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL6246, 10532346 (ID_REF), GDS5201, NM_001164833, NM_001164834, NM_153400, AB094663, AB094664, AY044240, BC106963, BC106964, chr5:110339812-110343212 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 117307627

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715381567.

P2rx2 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P498526 (ID_REF), GDS3890, NM_153400, A_51_P498526 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71538156

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75195768.

P2rx2 - MPSS transcriptome analysis project

Annotation:: P2rx2, Purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCTGTCCTTTCCCTG (ID_REF), GDS868, BE948568

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7519576

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 755953189.

P2rx2 - Type 2 diabetic (TALLYHO/JngJ x C57BL6) F2 males: liver, pancreas, muscle and adipose tissue

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS4000, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, transformed count, 64 samples

ID:: 75595318

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7061461810.

P2rx2 - Embryonic development of male reproductive tract tissues

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS3862, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70614618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7946252711.

P2rx2 - Model for inflammatory signaling in prostate epithelium based on expression of a constitutively active version of IκB kinase 2 (IKK2ca)

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL6246, 10532346 (ID_REF), GDS4119, NM_001164833, NM_001164834, NM_153400, AB094663, AB094664, AY044240, BC106963, BC106964, chr5:110339812-110343212 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 79462527

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1488311812.

P2rx2 - Serum response factor null mutation effect on neonatal cardiomyocytes

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS1486, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 14883118

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4681787213.

P2rx2 - Dicer inactivation effect on the embryonic heart

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL5025, 20372 (ID_REF), GDS3033, NM_153400

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46817872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2034091814.

P2rx2 - Graded HoxA10 expression effect on Lin(-) Sca1(+) c-kit(+) bone marrow cells

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS1809, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 20340918

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1721501815.

P2rx2 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS1647, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17215018

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1879112916.

P2rx2 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL2897, 230081 (ID_REF), GDS1729, NM_153400

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18791129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11940235617.

P2rx2 - Chronic, low level drug exposure effect on obese liver

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P498526 (ID_REF), GDS5258, NM_153400, A_51_P498526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119402356

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10677542718.

P2rx2 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL6246, 10532346 (ID_REF), GDS4898, NM_001164833, NM_001164834, NM_153400, AB094663, AB094664, AY044240, BC106963, BC106964, chr5:110339812-110343212 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106775427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1702061819.

P2rx2 - Nodose and dorsal root ganglia comparison (MG-430 2.0)

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL1261, 1435212_at (ID_REF), GDS1635, 231602 (Gene ID), BE948568

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 17020618

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4141872920.

P2rx2 - Nephronophthisis model

Annotation:: P2rx2, purinergic receptor P2X, ligand-gated ion channel, 2

Organism:: Mus musculus

Reporter:: GPL2897, 230081 (ID_REF), GDS2817, NM_153400

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41418729

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 48

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 231602) (956)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 956

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity