GEO Profile Links for Gene (Select 14182) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 53910471.

Fgfr1 - 4-nonylphenol effect on liver

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL144, M11 (ID_REF), GDS677, M28998

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 5391047

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1023673572.

Fgfr1 - Cmah knockout effect on mdx model of Duchenne Muscular Dystrophy (DMD): cardiac muscle

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1436551_at (ID_REF), GDS4770, 14182 (Gene ID), AW494469

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 102367357

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1224376903.

Flg - Anterior stomach vagotomy effect on INS-GAS gastric cancer model stomach: time course

Annotation:: Flg, filaggrin (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2455468 (ID_REF), GDS5336, FLG (ORF)

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122437690

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1304498304.

Fgfr1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P136162 (ID_REF), GDS5666, NM_010206, A_52_P136162 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130449830

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44882175.

Ppp2cb - Zygotic gene activation

Annotation:: Ppp2cb, protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 19117 (ID_REF), GDS579, AK090311, BC019161, BC037517, BC058582, CL301914, CL301921, BC053921, L0248G04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4488217

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 44649176.

Ppp2cb - Preimplantation development

Annotation:: Ppp2cb, protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 19117 (ID_REF), GDS578, AK090311, BC019161, BC037517, BC058582, CL301914, CL301921, BC053921, L0248G04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4464917

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 183939407.

Fgfr1 - MyD88-deficient macrophage response to lipopolysaccharide and E. coli (dye swap)

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1226, 3040 (ID_REF), GDS1706, NM_010206

DataSet type:: Expression profiling by array, log2 ratio, 15 samples

ID:: 18393940

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 423039568.

Fgfr1 - Myogenic transcription factor MyoD mutant expression effect on embryonic fibroblast: time course

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1424050_s_at (ID_REF), GDS2854, 14182 (Gene ID), M33760

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 42303956

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75251669.

Fgfr1 - MPSS transcriptome analysis project

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTCACTCTGGGTGGCT (ID_REF), GDS868, BC053921

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7525166

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 13046614710.

Fgfr1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P668810 (ID_REF), GDS5666, NM_010206, A_52_P668810 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130466147

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13046256011.

Fgfr1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P552062 (ID_REF), GDS5666, NM_010206, A_52_P552062 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130462560

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11230075612.

Fgfr1 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1424050_s_at (ID_REF), GDS5091, 14182 (Gene ID), M33760

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112300756

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11230261713.

Fgfr1 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425911_a_at (ID_REF), GDS5091, 14182 (Gene ID), M65053

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112302617

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766286614.

Fgfr1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTCACTCTGGGTGGCT (ID_REF), GDS878, BC053921

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7662866

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 115507315.

Fgfr1 - Alternatively activated macrophages

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL81, 97509_f_at (ID_REF), GDS240, 14182 (Gene ID), U22324

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 1155073

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4230581716.

Fgfr1 - Myogenic transcription factor MyoD mutant expression effect on embryonic fibroblast: time course

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425911_a_at (ID_REF), GDS2854, 14182 (Gene ID), M65053

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 42305817

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11252553017.

Fgfr1 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL4783, M300007787 (ID_REF), GDS2645, NM_010206, S74765

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112525530

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11849365618.

Fgfr1 - Dicer deficiency effect on preadipocytes

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1424050_s_at (ID_REF), GDS5234, 14182 (Gene ID), M33760

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118493656

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1720385619.

Fgfr1 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1424050_s_at (ID_REF), GDS1647, 14182 (Gene ID), M33760

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17203856

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4492591720.

Fgfr1 - Estrogen-related receptor beta mutation effect on the stria vascularis

Annotation:: Fgfr1, fibroblast growth factor receptor 1

Organism:: Mus musculus

Reporter:: GPL1261, 1425911_a_at (ID_REF), GDS2955, 14182 (Gene ID), M65053

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 44925917

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 14182) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity