ProfileGDS878 / GATCTGCGTACACCTGCGTC
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 92% 86% 86% 97% 99% 98% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)22992
GSM17241BLK.CL4 (MoBC.31Nc)10286
GSM17242BLK.CL4 (MoBC.30PN)11686
GSM17243Mouse liver (MoLi.231x)108597
GSM17244mouse liver (MoLi.251N)146999
GSM17245mouse liver (MoLi.241P)120798