ProfileGDS878 / GATCGCATTGCCAAGGAGGA
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 99% 99% 99% 83% 92% 92% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)190599
GSM17241BLK.CL4 (MoBC.31Nc)116499
GSM17242BLK.CL4 (MoBC.30PN)244699
GSM17243Mouse liver (MoLi.231x)12383
GSM17244mouse liver (MoLi.251N)17492
GSM17245mouse liver (MoLi.241P)23892