ProfileGDS878 / GATCCTTGGAAACGGGTTCT
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 92% 82% 87% 75% 79% 79% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)22392
GSM17241BLK.CL4 (MoBC.31Nc)8082
GSM17242BLK.CL4 (MoBC.30PN)12487
GSM17243Mouse liver (MoLi.231x)7975
GSM17244mouse liver (MoLi.251N)4979
GSM17245mouse liver (MoLi.241P)7179