ProfileGDS878 / GATCCGCTTGGCAGCCATTC
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 95% 91% 97% 91% 91% 94% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)37395
GSM17241BLK.CL4 (MoBC.31Nc)15691
GSM17242BLK.CL4 (MoBC.30PN)59697
GSM17243Mouse liver (MoLi.231x)29891
GSM17244mouse liver (MoLi.251N)13291
GSM17245mouse liver (MoLi.241P)38094