ProfileGDS878 / GATCCCTACTACGTGCTGGA
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 99% 99% 98% 88% 90% 86% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)182999
GSM17241BLK.CL4 (MoBC.31Nc)248299
GSM17242BLK.CL4 (MoBC.30PN)113198
GSM17243Mouse liver (MoLi.231x)20688
GSM17244mouse liver (MoLi.251N)12490
GSM17245mouse liver (MoLi.241P)12486