ProfileGDS878 / GATCAAAGGAAAGGGGAGGG
TitleMPSS analysis of BLK CL.4 and liver cells
OrganismMus musculus


BLK CL.4 liver total RNA nuclear RNA post-nuclear RNA total RNA nuclear RNA post-nuclear RNA GSM17228 GSM17241 GSM17242 GSM17243 GSM17244 GSM17245 99% 98% 99% 79% 82% 85% sort by cell type sort by protocol Gene Expression Profile
Graph caption help
SampleTitleValueRank
GSM17228BLK.CL4 (MoBC.29xx)243099
GSM17241BLK.CL4 (MoBC.31Nc)84698
GSM17242BLK.CL4 (MoBC.30PN)214799
GSM17243Mouse liver (MoLi.231x)10079
GSM17244mouse liver (MoLi.251N)6082
GSM17245mouse liver (MoLi.241P)11085