|
| Status |
Public on Aug 22, 2023 |
| Title |
Mutansoralis_Coculture_Saliva_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
whole cell lysate
|
| Organisms |
Streptococcus oralis; Streptococcus mutans |
| Characteristics |
tissue: whole cell lysate
genotype: UA159 / 34
treatment: Saliva; growth to OD600 0.4
|
| Treatment protocol |
Cells were harvested by centrifugation at 4°C for 5 min, treated with bacterial RNAprotect Bacteria Reagent (Qiagen), and immediately stored at -80°C.
|
| Growth protocol |
Bacterial cells used for extraction of RNA were grown in TY medium, with or without 50% human saliva, in the presence of 5% CO2 at 37°C without agitation, until they reached mid-exponential phase (OD600 ≈ 0.4)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from bacterial cells using the RNeasy Mini kit (Qiagen), with chromosomal DNA removed using a DNase I kit (Qiagen). To remove 16S and 23S rRNAs, 10 µg of total RNA was treated using the MICROBExpressTM Bacterial mRNA Enrichment Kit
cDNA libraries were created from 100 ng enriched mRNA samples using the NEBNext Ultra Directional RNA Library Prep kit for Illumina and NEBNext multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA) following instructions from the supplier.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
16_Co_Saliva_So34 / 16_Co_So34_Saliva
|
| Data processing |
Step 1: FASTQ Groomer
Step 2: FASTQ Quality Trimmer
Step 3: Cutadapt removing GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Step 4: Map with Bowtie for Illumina
Step 5: sort
Step 6: htseq-count (see our publication for details)
Assembly: NC_004350.2 for S. mutans UA159; CP079724.1 for S. oralis
Supplementary files format and content: tab-delimited text file includes raw counts for each sample
|
| |
|
| Submission date |
Jul 27, 2023 |
| Last update date |
Aug 22, 2023 |
| Contact name |
Justin Ray Kaspar |
| E-mail(s) |
[email protected]
|
| Phone |
6142923773
|
| Organization name |
The Ohio State University
|
| Department |
Biosciences
|
| Lab |
Kaspar
|
| Street address |
305 W 12th Ave
|
| City |
Columbus |
| State/province |
OH |
| ZIP/Postal code |
43210 |
| Country |
USA |
| |
|
| Platform ID |
GPL33630 |
| Series (1) |
| GSE239483 |
Human saliva modifies growth, biofilm architecture and competitive behaviors of oral streptococci |
|
| Relations |
| BioSample |
SAMN36733464 |
| SRA |
SRX21176416 |
