 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 03, 2022 |
| Title |
BAFexp_H1_NOTF_BC01_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Plasmid-amplified sequence
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Plasmid-amplified sequence
condition: Compacted Array
|
| Treatment protocol |
Nucleosome Arrays: nucleosome arrays were assembled as previously described 16 . Assembly reactions containing 2 μg of end-labeled DNA fragments and core histones at a 1:1.0 molar ratio of octamers to nucleosomal sites, and 2 M NaCl in a total of 10 μl were incubated at 37°C for 15 min, serially diluted by adding 3.3, 6.7, 5, 3.6, 4.7, 6.7, 10, 30, and 20 μl of 50 mM HEPES (pH 7.5), 1 mM EDTA, 5 mM DTT, and 0.5 mM PMSF in 15 min incubation steps at 30°C, and brought to 0.1 M NaCl by adding 100 μl of 10 mM Tris·HCl (pH 7.5), 1 mM EDTA, IGEPAL, 5 mM DTT, 0.5 mM PMSF, and 20% glycerol, followed by incubation at 30°C for 15 min. Array saturation was determined by EcoRI digestion, performed with a concentration of 2 nM nucleosome array or free DNA in 20 mM HEPES (pH 7.5), 50 mM KCl, 1% glycerol, 5 mM DTT, 100 μg/ml BSA, and 2 U/μl EcoRI. Following a 2 hr incubation at 37°C, digestion products were resolved on 4% polyacrylamide 0.5X TBE gels and analyzed as described 16 . Cx3cr1 mononucleosomes were reconstituted by dialysis with the Cy5 end-labeled 162bp Cx3cr1 DNA fragment and recombinant human histones as described previously 13.
TF Binding: binding reactions for the DNase I digestion, MNase, and Restriction enzyme assays were carried out with 1 nM (1.5 ng/μl) of nucleosome array (13 nM of nucleosomes) in 6 mM HEPES (pH 7.5), 35 mM KCl, 1.5% glycerol, 2 mM DTT, 250 μg/ml BSA. In experiments with compacted nucleosome arrays, 13 nM purified histone H1 (Calbiochem) was incubated with the nucleosome arrays at room temperature for 1 hr. Purified transcription factors were then incubated with the nucleosome arrays at room temperature for 1 hr. For cBAF remodeling assays 10nM of indicated transcription factors were incubated with H1-compacted arrays at room temperature followed by incubation with cBAF (6 nM) and ATP (0.5mM) for 30 minutes at 30°C.
DNase digestions were carried out by 2.5-10 ug/mL of DNase I diluted in 50 mM MgCl 2 , followed by incubation at room temperature for 1 min. MNase digestion was performed by addition of .075-0.6 U/mL MNase diluted in 30 mM CaCl2, followed by incubation at room temperature for 1 min. XbaI restriction enzyme digestion was performed by incubation with 0.25- 1 U/mL XbaI for 45 minutes at 30°C. Reactions were terminated by addition of 1 volume of stop buffer (20 mM Tris pH 7.5, 50 mM EDTA, 1% SDS, 0.5 mg/mL tRNA, and 0.2 mg/mL proteinase K) and incubated at 50C for 15 min. Digestion products are purified by ethanol precipitation and electrophoresed on 1% Agarose 1X TBE gels.
|
| Growth protocol |
Plasmids were amplified in E.coli, purified, and digested with MluI, SmaI and HhaI to release array fragments. Fragments were purified by ethanol precipitation then labeled with579 dCTP-Cy5 (Cytiva PA55021) by end-repair with Klenow fragment DNA polymeraase (3’-5’ exo-) (NEB). Cy5-DNA labeling reactions were carried out at final concentrations of 1 μM DNA, 4 mM Cy5-dCTP and 0.5 U/μL Klenow fragment in the presence of excess 4mM dATP, 4 mM dTTP, and 4 mM dGTP in NEB buffer 2 (50mMNaCl, 10mM Tris-HCl, 10 mM MgCl 2 , 1 mM DTT). The reaction was incubated at 37C for 1 hr. Labeling reactions were purified by phenol:chloroform extraction followed by FPLC purification of the 2.7 kb MluI-SmaI fragment using a Capto HiRes Q anion exchange column (Cytiva 29275878).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Partially MNase-digested chromatin retaining contiguous oligonucleosomes was used for generation of libraries for nanopore sequencing. Purified DNA was end-repaired and A-tailed with the NEBnext Ultra II end repair module (New England Biolabs), purified with Ampure XP beads (Beckman Coulter) and ligated to AMX adapter from the Oxford Nanopore 1D sequencing Kit (SQK-LSK108, Oxford Nanopore Technologies) using NEB Blunt/TA ligase master mix. Excess adapters were removed by adding 0.5 volumes of Ampure XP beads and washing with ABB buffer from the 1D sequencing kit. Purified library was eluted and loaded to a MinION R9.4 flowcell according to the manufacturer’s instructions and run for 24 h.
|
| |
|
| Library strategy |
MNase-Seq |
| Library source |
genomic |
| Library selection |
MNase |
| Instrument model |
MinION |
| |
|
| Data processing |
Array construction: the 162 bp Cx3cr1 mononucleosome sequence that corresponds to the genomic location: mm9 chr9:119946611-119946762 13 was extended on either side by 35 bp to incorporate linker DNA and BfuAI and XbaI flanking sequences: ACCTGCGTTACAGCATCCACTCAGTATCCCTTGAGCCCCGCGTGCAAAGCCCAGGAGCCCTTGCTTAGGTGCAGGGCCTCTCGGCTGCTGATCTTCAGCTGGTTGCTGAGAGTTGCAGCATTGCTGAGTCTTAGCAATGATACTTCCCGATTCCCCTCACAAAAATAGGTCAGTCTGTCTG553 GCTAGTTCTGTACTTGCAGACACAGGGCATGTGGGGTTCCTATTTTTCTAGCTCCCAGGCT TCTGTCTGCTTCCTTCGTTTAGTATGTCTA
The DNA sequence was generated by PCR of genomic mouse DNA with BfuAI and XbaI restriction sites cloned into the p208-10.N1N2 16 to generate p208-10-Cx3cr1. Mutant Cx3cr1 arrays were generated by infusion cloning using linearized BfuAI XbaI digested p208-10-Cx3cr1 plasmids. Geneblocks for cloning were obtained from IDT:
TF mutant motif Cx3cr1:
AAAATAACCTGCGTTACAGCATCCACTCAGTATCCCTTGAGCCCCGCGTGCAAAGCCCAGGAGCCCTTGCTTAGGTGCAGGGCCTCTCGGCTGCTGATCTTCAGCTGGTTGCTGAGAGTTGCAGCATTGCTGAGTCCCGTATAGAGATCGTATAGCGTATAGAGCACAAAAATAGGTCAGTCTGTCTGGCTAGTTCTGTACTTGCAGACACAGGGCATGTGGGGTTCCTATTTTTCTAGCTCCCAGGCTTCTGTCTGCTTCCTTCGTTTAGTATGTCTAGACTACAGTTATTGGTT
Swap1 Cx3cr1:
AAAATAACCTGCGTTACAGCATCCACTCAGTATCCCTTGAGCCCCGCGTGCAAAGCCCAGGAGCCCTTGCTTAGGTGCAGGGCCTCTCGGCTGCTGATCTTCAGCTGGTTGCTGAGAGTTGCAGCATTGCTGAGTCTACTTCCCGAATTAGCAATGGTTCCCCTCACAAAAATAGGTCAGTCTGTCTGGCTAGTTCTGTACTTGCAGACACAGGGCATGTGGGGTTCCTATTTTTCTAGCTCCCAGGCTTCTGTCTGCTTCCTTCGTTTAGTATGTCTAGACTACAGTTATTGGTT
Swap2 Cx3cr1:
AAAATAACCTGCGTTACAGCATCCACTCAGTATCCCTTGAGCCCCGCGTGCAAAGCCCAGGAGCCCTTGCTTAGGTGCAGGGCCTCTCGGCTGCTGATCTTCAGCTGGTTGCTGAGAGTTGCAGCATTGCTGAGTCTACTTCCCGAATTAGCAATGGTTCCCCTCACAAAAATAGGTCAGTCTGTCTGGCTAGTTCTGTACTTGCAGACACAGGGCATGTGGGGTTCCTATTTTTCTAGCTCCCAGGCTTCTGTCTGCTTCCTTCGTTTAGTATGTCTAGACTACAGTTATTGGTT
Transformation to FASTQ: the fast5 raw data files from the Nanopore sequencer were basecalled and converted to fastq format with Guppy Software (Oxford Nanopore Technologies).
Alignment: reads were mapped to the Cx3cr1 Array reference with minimap2, a mapping algorithm specifically designed to analyze nanopore sequencing reads.
Quality Control: BAM files produced by minimap2 were imported into R 44 then filtered and normalized using tidyverse packages 45 .Specifically, reads were excluded if they were identified as multimappers by minimap2 or were located entirely within the non- unique regions of the nucleosome array DNA sequence.
Track Creation: the ends of each read from an array digestion identify the precise nucleotide at which a nuclease was able to access and cleave the DNA in the array. We quantified the endpoints of each read using the hash package and then normalized each dataset to the total number of mapped reads, resulting in provided bigWigs.
Assembly: mm9
Supplementary files format and content: BigWig files represent pile-ups of fragment endpoints, indicating nuclease cleavage sites
|
| |
|
| Submission date |
Oct 19, 2022 |
| Last update date |
Nov 03, 2022 |
| Contact name |
Gregory Donahue |
| Organization name |
The University of Pennsylvania
|
| Department |
Cell & Developmental Biology
|
| Lab |
Zaret Lab
|
| Street address |
3400 Civic Center Blvd, Bldg 421
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL24973 |
| Series (1) |
| GSE216065 |
A pioneer factor locally opens compacted chromatin to enable targeted ATP-dependent nucleosome remodeling |
|
| Relations |
| BioSample |
SAMN31362299 |
| SRA |
SRX17953342 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6658060_BAFexp_H1_NOTF_BC01_R1.bw |
46.5 Kb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
