 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 04, 2022 |
| Title |
wDah_male_Ago2IP_35d_exp2 |
| Sample type |
SRA |
| |
|
| Source name |
whole body
|
| Organism |
Drosophila melanogaster |
| Characteristics |
tissue: whole body
strain: wDah
Sex: male
genotype: wDah
ip antibody: anti-Ago2 (BRD-GP-5 BRD-GP-6)
age: 35 days
|
| Growth protocol |
Flies were kept at 25°C, fed banana agar, and flipped weekly. Males and females of the same genotype were kept together. Young and old of the same genotype and replicate were siblings.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
40 whole flies were homogenized in 500 µl of chilled lysis buffer (Kadener, Menet et al. 2009). Lysates were incubated on ice for 10 minutes and centrifuged at 15,000 rpm for 15 minutes at 4 °C.
For the Ago1 immunoprecipitation 4 µl of BRD-GP-3 and 4 µl BRD-GP-4 were added to 100 µl of lysate. For the Ago2 immunoprecipitation, the same was done with BRD-GP-5 and BRD-GP-6. Lysates with antibody were incubated with rotation for 1 hour at 4 °C.
50 µl of 25% slurry Pierce protein A/G magnetic agarose (Thermo Fisher) were prepared for each IP. The magnetic agarose was washed in 1 ml of lysis buffer three times before being resuspended in the original volume.
40 µl of slurry were aliquoted into new tubes, supernatant was removed, and the lysates with antibody were added. Lysates and magnetic agarose were incubated overnight with rotation at 4 °C.
Agarose was washed five times for 5 minutes in 500 µl of lysis buffer at 4 °C before elution for RNA extraction with Trizol
Small RNA libraries were constructed using the NEBNext® Small RNA Library Prep Set for Illumina®(New England Biolabs).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
wDa_m_A2_35do_exp2
IP_sample_index20_exp2
AgoIP_mappedtomiRNAstransposons_prenormalization.txt
AgoIP_mappedtomiRNAstransposons_normalized.txt
AgoIP_mappedtomiRNAstransposons_21nt_prenormalization.txt
AgoIP_mappedtomiRNAstransposons_21nt_normalized.txt
AgoIP_mappedtodm6_prenormalization.txt
AgoIP_mappedtodm6_normalized.txt
|
| Data processing |
Galaxy web platform (usegalaxy.org (Afgan, Baker et al. 2018)) and the Mississippi server sponsored by the ARTbio bioinformatics facility of the Institut de Biologie Paris Seine based at the University Pierre & Marie Curie
Adapters were removed using the application Trim Galore! designed by Felix Krueger on default settings and inputting the adapter sequence GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT to remove it.
The trimmed sequence files were processed through the Reverse-Complement application.
These trimmed and reverse complimented files were then size selected using Filter FASTQ (Blankenberg, Gordon et al. 2010) to filter out reads longer than 25 nt and filtered to only include 21 nt reads for transposon siRNA analysis
Reads were mapped to the dm6 genome or an in-house FASTA of spike-ins (Gainetdinov, Colpan et al. 2018), known Drosophila transposons, mature miRNAs, and miR* strands using sR_bowtie (Langmead, Trapnell et al. 2009) set to match and report all valid alignments with 1 mismatch allowed
Alignments were quantified using featureCounts (Liao, Smyth et al. 2014). miRNAs, miR* strands, and transposons with an average of less than 5 reads across the libraries were removed from analysis to avoid noise using DEBrowser v1.18.2 (Kucukural, Yukselen et al. 2019)
Replicates were averaged togather
Libraries were normalized by total mapped reads as adapted from described (Czech, Malone et al. 2008, Czech, Zhou et al. 2009)
Assembly: dm6
Supplementary files format and content: prenormalization files are tab delimited files composed of featureCounts outputs
Supplementary files format and content: Normalized files are tab delimited files normalized as percent of total reads mapped
|
| |
|
| Submission date |
Sep 01, 2022 |
| Last update date |
Sep 04, 2022 |
| Contact name |
Siobhan Gartland |
| Organization name |
Brandeis University
|
| Department |
Biology
|
| Lab |
Marr
|
| Street address |
415 SOUTH STREET
|
| City |
Waltham |
| State/province |
MA |
| ZIP/Postal code |
02453 |
| Country |
USA |
| |
|
| Platform ID |
GPL19132 |
| Series (2) |
| GSE212492 |
Effect of aging and dFOXO knockout on small RNA in Ago1 and Ago2 RNA-induced silencing complexes |
| GSE212494 |
The small RNA landscape across age and loss of dFOXO in Drosophila |
|
| Relations |
| BioSample |
SAMN30625098 |
| SRA |
SRX17390485 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
