|
| Status |
Public on Aug 09, 2022 |
| Title |
SU-DHL-1 |
| Sample type |
SRA |
| |
|
| Source name |
anaplastic large-cell lymphoma cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cancer type: anaplastic large-cell lymphoma
|
| Treatment protocol |
No special treatment of the cells was applied.
|
| Growth protocol |
Standard cell culture of wild-type cell lines.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were harvested and RNA was isolated with Trizol.
Depletion of ribosomal RNA. Exonuclease digest and negative selection of poly(A) transcripts to enrich for circular RNAs. cDNA library preparation (SMARTer) and PCR amplification.
Oxford Nanopore long-read RNA sequencing (SQK-LSK109 kit with native barcoding kit EXP-NBD104, BC01-04)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
MinION |
| |
|
| Data processing |
Fastq raw data cleaning with cutadapt-3.4 (cutadapt -e 0.2 -m 1 -g AAGCAGTGGTATCAACGCAGAGTAC -o FileName_5pTrimmed.fastq.gz FileName.fastq.gz then cutadapt -e 0.2 -m 1 -a GTACTCTGCGTTGATACCACTGCTT -o TrimmedFileName.fastq.gz FileName_5pTrimmed.fastq.gz)
circRNA identification with CIRI-long-v1.0.3 (CIRI-long call -i TrimmedFileName.fastq.gz -o step1 -r genome.fa -p SampleName -a genome.gtf -t 10 then CIRI-long collapse -i SampleFile.lst -o step2 -p SampleName -r genome.fa -a genome.gtf -t 10)
Genome_build: Homo_sapiens.GRCh38.dna.MAIN.fa and Homo_sapiens.GRCh38.87.chr.gtf
Supplementary_files_format_and_content: tab-delimited text files reporting circRNA candidates (two columns : Id and counting) Id under the form chr:begin-end
|
| |
|
| Submission date |
Mar 03, 2022 |
| Last update date |
Aug 09, 2022 |
| Contact name |
FABIENNE MEGGETTO |
| E-mail(s) |
[email protected]
|
| Phone |
0582741669
|
| Organization name |
CRCT
|
| Street address |
2 AVENUE HUBERT CURIEN
|
| City |
TOULOUSE |
| ZIP/Postal code |
31037 |
| Country |
France |
| |
|
| Platform ID |
GPL24106 |
| Series (1) |
| GSE197872 |
Generation of full-length circRNA libraries for Oxford Nanopore long-read sequencing |
|
| Relations |
| BioSample |
SAMN26419520 |
| SRA |
SRX14360486 |
