|
| Status |
Public on Apr 26, 2023 |
| Title |
Fkh1_R1 |
| Sample type |
SRA |
| |
|
| Source name |
bound fragments from in vitro library
|
| Organism |
synthetic construct |
| Characteristics |
round: 1
protein: Fkh1
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
The protein of interest was incubated with the randomized library and run on a non-denaturing polyacrylamide gel at 4 ⁰C. Bound fragments were excised and purified using phenol:chloroform:isoamyl extraction. An aliquot was then used for an additional round of selection and extraction. Illumina adapters and barcodes and were then added to the selected libraries usng 4 cycle PCR, and samples were sent for sequencing.
A hand-mixed library containing a 16 bp randomized region was ordered from IDT with standard desalting. The library was made double stranded using the Klenow reaction.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
processed data file:
Fkh1_core_ddG.tsv
Fkh1_edge_ddG.tsv
|
| Data processing |
library strategy: SELEX-seq
Fixed adapters are trimmed using cutadapt v2.10, leaving only bases of the 16 bp variable region (Test Samples: cutadapt -g ^CGC -a CCTGGAATTCTCGGGTGCCAAGGAACTCCAG$ -O 10 -n 2 --discard-untrimmed --max-n 0 -m 16 -M 16; Production Samples: cutadapt -g ^CAG -a TCCGTATCGCTCCTCCAATG$ -O 10 -n 2 --discard-untrimmed --max-n 0 -m 16 -M 16)
Unexpected runs of cytidine were present in the Fhl1 samples, reads with runs of at least 7 cytidines were removed
The relative enrichment of various length k-mers are calculated using the same process as the SELEX package on bioconductor, the square root of the enrichment is provided for R2 samples
Supplementary files format and content:
tsv files that can be easily viewed in excel or a text editor of your choice
folders of tsv files are archived and compressed into tar.gz format
|
| |
|
| Submission date |
Jun 24, 2021 |
| Last update date |
Apr 26, 2023 |
| Contact name |
Remo Rohs |
| Organization name |
University of Southern California
|
| Department |
Quantitative and Computational Biology
|
| Lab |
Rohs Lab
|
| Street address |
1050 Childs Way
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90089 |
| Country |
USA |
| |
|
| Platform ID |
GPL19424 |
| Series (1) |
| GSE178811 |
DNA Binding Specificities of Fkh1, Fkh2, Hcm1, and Fhl1 Revealed by SELEX-seq |
|
| Relations |
| BioSample |
SAMN19855073 |
| SRA |
SRX11218620 |
