|
| Status |
Public on Apr 21, 2021 |
| Title |
0 min post infection, Vector 2 |
| Sample type |
SRA |
| |
|
| Source name |
Bacteria
|
| Organism |
Escherichia coli str. K-12 substr. MG1655 |
| Characteristics |
strain: K-12 substr. MG1655
plasmid: pNW129
|
| Growth protocol |
E. coli str. K-12 substr. MG1655 containing either pNW129 or pNW129-MotB were grown to early log phase (OD600 ~ 0.3) then induced with 0.2% arabinose for 20 minutes. Phage T4 was added to the culture at MOI 10.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated using method II of (Hinton 1989)
The cDNA library was prepared using a modified RNATagSeq workflow as previously described (Shishkin, A.A. et al. 2015 Nat Methods). Optimum fragmentation of the total RNA samples in this library was determined to be 3 min at 94C in FastAP buffer (Thermo Fischer Scientific). The cDNA Library was run on a Bioanalyzer using the Agilent High Sensitivity DNA Kit to evaluate the quality of the library. The concentration of the cDNA library was determined by qPCR using the KAPA Library Quantification Kit (Kapa Biosystems, Wilmington, MA, USA) and CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Read data in fastq format was demultiplexed and aligned to E. coli str. K-12 substr. MG1655 (NC_000913.3) or E. coli virus T4 (NC_000866.4) reference genome using STAR v2.5.2
Default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1.
RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package
Count data was normalized using Deseq2, which utilizes a normalization of means method for sample normalization and comparison.
Differential expression between conditions was represented as a fold change, and genes with both a fold change ≥2 or ≤ 0.5and adjusted p value ≤ 0.05 were considered significant.
Genome_build: NC_000913.3 or NC_000866.4
Supplementary_files_format_and_content: Comma seperated value text files include: 1) the fold change of each gene in two different samples determined using subread featureCounts v1.4.6-p3 package; 2) Benjamini-Hochberg p-value.
|
| |
|
| Submission date |
Apr 20, 2021 |
| Last update date |
Apr 21, 2021 |
| Contact name |
Deborah Hinton |
| E-mail(s) |
[email protected]
|
| Organization name |
NIDDK
|
| Street address |
8 Center drive
|
| City |
Bethesda |
| State/province |
MD |
| ZIP/Postal code |
20892 |
| Country |
USA |
| |
|
| Platform ID |
GPL17439 |
| Series (1) |
| GSE172467 |
DNA compaction by a novel viral-encoded protein globally dysregulates host gene expression. |
|
| Relations |
| BioSample |
SAMN18813743 |
| SRA |
SRX10647055 |
