|
Status |
Public on Jan 12, 2021 |
Title |
CT22_20190613_AR13 |
Sample type |
SRA |
|
|
Source name |
Adult neurons
|
Organism |
Drosophila melanogaster |
Characteristics |
cell type: Clk856-Gal4 labeled neurons age: Adult treatment: DD3
|
Treatment protocol |
No treatment
|
Growth protocol |
Flies were reared in standard cornmeal medium with yeast under 12:12 h LD cycles.
|
Extracted molecule |
total RNA |
Extraction protocol |
The single cell library prep was based on CEL-seq2 with some modifications. Two rounds in vitro transcriptions were used to amplify ploly A mRNA. The RNA from the first round of IVT was purified by 0.8 fold RNAClean XP beads (0.8 fold ratio) and was used as a substrate for another round of first strand synthesis at 42 °C for 2 hours using second round primers (2nd Round Primer: NNNNNN), RNA:DNA hybrids were digested with RNase H (Thermal Fisher #18021014) at 37 °C for 30 minutes. The second round second strand synthesis was carried out at 16 °C with a T7-RA5 primer (GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC). The resulting cDNA underwent another final second round IVT step at 37 °C overnight and followed EXO-SAP treatment (Affymetrix 78200) for 15 minutes at 37 °C. Other steps were performed as described in the CEL-Seq2 protocol.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
bcl2fastq v2.20 was used to convert the raw sequencing files into fastq files zUMI v2.1.1 was used to align the reads to Drosophila genome Genome_build: dm6 Supplementary_files_format_and_content: read counts
|
|
|
Submission date |
Sep 04, 2020 |
Last update date |
Jan 12, 2021 |
Contact name |
Michael Rosbash |
Organization name |
Brandeis University
|
Street address |
415 South street
|
City |
Waltham |
ZIP/Postal code |
02453 |
Country |
USA |
|
|
Platform ID |
GPL19132 |
Series (1) |
GSE157504 |
A transcriptomic taxonomy of Drosophila circadian neurons around the clock |
|
Relations |
BioSample |
SAMN16059608 |
SRA |
SRX9075987 |