|
| Status |
Public on Jan 12, 2021 |
| Title |
CT14_20190702_AR19 |
| Sample type |
SRA |
| |
|
| Source name |
Adult neurons
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell type: Clk856-Gal4 labeled neurons
age: Adult
treatment: DD3
|
| Treatment protocol |
No treatment
|
| Growth protocol |
Flies were reared in standard cornmeal medium with yeast under 12:12 h LD cycles.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The single cell library prep was based on CEL-seq2 with some modifications. Two rounds in vitro transcriptions were used to amplify ploly A mRNA. The RNA from the first round of IVT was purified by 0.8 fold RNAClean XP beads (0.8 fold ratio) and was used as a substrate for another round of first strand synthesis at 42 °C for 2 hours using second round primers (2nd Round Primer: NNNNNN), RNA:DNA hybrids were digested with RNase H (Thermal Fisher #18021014) at 37 °C for 30 minutes. The second round second strand synthesis was carried out at 16 °C with a T7-RA5 primer (GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC). The resulting cDNA underwent another final second round IVT step at 37 °C overnight and followed EXO-SAP treatment (Affymetrix 78200) for 15 minutes at 37 °C. Other steps were performed as described in the CEL-Seq2 protocol.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
bcl2fastq v2.20 was used to convert the raw sequencing files into fastq files
zUMI v2.1.1 was used to align the reads to Drosophila genome
Genome_build: dm6
Supplementary_files_format_and_content: read counts
|
| |
|
| Submission date |
Sep 04, 2020 |
| Last update date |
Jan 12, 2021 |
| Contact name |
Michael Rosbash |
| Organization name |
Brandeis University
|
| Street address |
415 South street
|
| City |
Waltham |
| ZIP/Postal code |
02453 |
| Country |
USA |
| |
|
| Platform ID |
GPL19132 |
| Series (1) |
| GSE157504 |
A transcriptomic taxonomy of Drosophila circadian neurons around the clock |
|
| Relations |
| BioSample |
SAMN16059747 |
| SRA |
SRX9075977 |
