 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 21, 2023 |
| Title |
E56-9 |
| Sample type |
SRA |
| |
|
| Source name |
ovary
|
| Organism |
Heterocephalus glaber |
| Characteristics |
age: Embryonic day 56
genotype: wild type
|
| Treatment protocol |
none
|
| Growth protocol |
lab colony
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. RNA concentration was determined on a Nanodrop.
Ribosomal RNA was subtracted by hybridization from total RNA samples using the RiboZero Magnetic Gold H/M/R Kit (Illumina) using 100ng total RNA and a modified protocol scaled for lower input (90ul magnetic bead stock, and 2 ul removal solution in a 20ul reaction). The rRNA-depleted RNA samples were cleaned up by ethanol precipitation. TruSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
E56 Litter mates
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.1 (--library-type=fr-firststrand -G GCF_000247695.1_HetGla_female_1.0_genomic.gff) was used to map reads to the HetGla_female_1.0 reference.
Mapped reads were analyzed for transcript expression using cufflinks v2.2 (ref 3). A common transcriptome annotation file was generated with cuffmerge and used to generate FPKM values and statistical analysis of differential gene expression with cuffdiff.
Genome_build: HetGla_female_1.0 (GCF_000247695.1)
Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples. Transcript annotation is in gtf format (merged.gtf).
|
| |
|
| Submission date |
Oct 28, 2019 |
| Last update date |
Feb 21, 2023 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL24046 |
| Series (1) |
| GSE139515 |
Postnatal Oogenesis In the Naked Mole Rat |
|
| Relations |
| BioSample |
SAMN13149193 |
| SRA |
SRX7066627 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
