|
| Status |
Public on Mar 09, 2020 |
| Title |
BRH.1429986_S11 |
| Sample type |
SRA |
| |
|
| Source name |
Serum
|
| Organism |
Homo sapiens |
| Characteristics |
phenotype: Control
time: 0 hr
Sex: male
age: 28
race: hispanic
injury type: Control
subtype: ND
biofluid: Serum
years from tbi: ND
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total cellular RNA was extracted using Ribopure (Ambion) according to the manufacturer’s recommendations
New England Biolabs NEBNext Small RNA library Prep following the manufacturer’s protocol
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Conversion from bcl files to fastq and demultiplexing with Illumina Bcl2fastq2 version 2.20.0.422
Adapter trimming and collapsing indentical reads with the mapper.pl function of miRDeep2.0.0.8 using the command “mapper.pl input.fastq -e -v -u -h -k AGATCGGAAGAGCACACGTCT -l 18 -m -s output.collapsed.fasta”
Quantifying miRNA reads with the miRDeep2.0.0.8 quantifier.pl function with the -W parameter, using miRBase release 21.
Genome_build: miRBase Release 21
Supplementary_files_format_and_content: tab delimited table of miRNA read counts
|
| |
|
| Submission date |
May 23, 2019 |
| Last update date |
Mar 10, 2020 |
| Contact name |
Helen Lee Hellmich |
| E-mail(s) |
[email protected]
|
| Phone |
409-772-4216
|
| Organization name |
University of Texas Medical Branch
|
| Department |
Anesthesiology
|
| Street address |
601 Harborside Dr. Bldg.21 Rm 3.202H
|
| City |
Galveston |
| State/province |
TX |
| ZIP/Postal code |
77555 |
| Country |
USA |
| |
|
| Platform ID |
GPL21697 |
| Series (1) |
| GSE131695 |
microRNA expression in human traumatic brain injury biofluids |
|
| Relations |
| BioSample |
SAMN11840641 |
| SRA |
SRX5888187 |
