NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3724229 Query DataSets for GSM3724229
Status Public on Jul 11, 2019
Title HEK293T-NT-miniABEmax-rep3
Sample type SRA
 
Source name HEK293T
Organism Homo sapiens
Characteristics cell line: HEK293T
treatment: miniABEmax-P2A-EGFP
guide rna: NT guide:GGAGACGATTAATGCGTCTC
gfp: All GFP
Treatment protocol Transfections were performed using 50ug of transfection quality plasmid DNA (Qiagen Maxiprep) encoding desired ABEmax-P2A-EGFP or bpNLS-32AAlinker-nCas9-bpNLS-P2A-EGFP and gRNAs (nuclease-to-gRNA ratio 75:25%). 7x10E6 HEK293T were seeded into TC-treated 150mm plates 18-24h prior to transfection to yield ~60-80 % confluency on the day of transfection. Cells were transfected using 150uL TransIT-293 (HEK293T, Mirus) reagents per plate, according to the manufacturers’ protocols (mixing DNA and reagent in 5mL Optimem, 30min incubation). Cells were sorted 36-40h after transfection, for all GFP signal after doublet-exclusion and gating for the cell population on a BD FACSARIA II.
Growth protocol HEK293T cells (CRL-3216, obtained from ATCC) were grown in culture using media consisting of DMEM (Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco). Cells were used for experiments until passage 20 and passaged at ~80% confluency every 2-4 days to maintain an actively growing population and avoid anoxic conditions. Cells were tested for mycoplasma bi-weekly.
Extracted molecule total RNA
Extraction protocol RNA was extracted with Macherey-Nagel’s NucleoSpin RNA Plus kit.
Illumina TruSeq Stranded Total RNA Gold, IDT-ILM unique dual indices for barcoding.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Description 251C
miniABEmax
processed data: ABE_SECURE_counts.tsv
Data processing RNA sequencing data was aligned to the human reference genome (GRCh38/hg38) using STAR using a basic two-pass alignment strategy. Aligned reads were filtered for those reads that were uniquely mapping using the --outFilterMultimapNmax 1 flag.
Variants associated with BE treatment were called using the GATK best practices pipeline using GATK 3.8.1 and Picard 2.7.
No samples were excluded from bioinformatics analyses.
Genome_build: hg38 (GRCh38)
Supplementary_files_format_and_content: ABE_SECURE_counts.tsv: Raw gene expression counts per gene estimated by STAR.
 
Submission date Apr 16, 2019
Last update date Jul 11, 2019
Contact name Caleb Lareau
E-mail(s) [email protected]
Organization name Memorial Sloan Kettering
Street address 417 E 68th St, Zuckerman - ZRC 1132
City New York
State/province New York
ZIP/Postal code 10065
Country USA
 
Platform ID GPL24676
Series (2)
GSE129889 CRISPR adenine and cytosine base editors with reduced RNA off-target activities [ABE]
GSE129894 CRISPR adenine and cytosine base editors with reduced RNA off-target activities
Relations
BioSample SAMN11435888
SRA SRX5694047

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap