|
| Status |
Public on Jun 28, 2019 |
| Title |
HNF4alpha2-GFP, replicate 3 [A2N3] |
| Sample type |
SRA |
| |
|
| Source name |
Cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HCT116
cell type: Colorectal cancer cell
hnf4alpha isoforms: Isoform 2
growth media: DMEM 10%, Penecillin (100U/ml), Streptomycin (100 ug/ml), Blasticidin S (5 ug/ml), Hygromycin B (100 ug/ml).
|
| Treatment protocol |
To induced the expression of HNF4alpha's isoforms, cells were incubated for 48 hours in DMEM 10% FBS +Pen/Strep containing 2.5 ug/ml of doxycyclin. The selection antibiotics hygromicin B, blasticidin S and zeocin normally used to maintain the cell lines were removed from media upon induction of HNF4alpha's isoforms expression. Empty control cells were treated the same way as the ones containing the HNF4alpha's constructs.
|
| Growth protocol |
Cell were grown in DMEM 10% FBS containing penecillin and streptomycin. Depending on the cell line, blasticidin, zeocin and hygromycin was added or not to culture media in order to maintain the constructs. Cells were cultivated at 37oC in an atmosphere containing 5% carbon dioxide (CO2) and kept at sub-confluency.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA were extracted from cells using QIAGEN RNeasy mini kit.
The mRNA enrichment was performed using the NEBNext Poly(A) Magnetic Isolation Module (New England BioLabs). cDNA synthesis was achieved with the NEBNext RNA First Strand Synthesis and NEBNext Ultra Directional RNA Second Strand Synthesis Modules (New England BioLabs). The remaining steps of library preparation were done using and the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
processed data file:
HNF4A2.tsv
|
| Data processing |
FASTQ files were filtered using Trimmomatic 0.36 (PE ILLUMINACLIP:adapters.fa:2:30:10 LEADING:25 TRAILING:25 MINLEN:45), and the quality was assessed with FastQC 0.11.5. The adapter fasta file contains the two NEBNext dual sequences (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT)
Complete read pairs were aligned and quantified on a human transcriptome using Kallisto 0.44.0 (index built with –kmer-size=31). The transcriptome was generated with gffread, using the GRCh38.p12 genome and the latest RefSeq annotation (NCBI Homo sapiens Annotation Release 109).
Differential expression was calculated using DESeq2 1.22.2. All isoforms were individually compared to the empty control.
Genome_build: GRCh38.p12
Supplementary_files_format_and_content: Results from each isoform are presented in a different file. The first three columns are expressions (in TPM) from the Kallisto output. The fourth column is the gene symbol. The other columns are the standard output from DESeq2. The empty control (A0) does not have results from DESeq2
|
| |
|
| Submission date |
Jan 29, 2019 |
| Last update date |
Jun 28, 2019 |
| Contact name |
Francois Boudreau |
| E-mail(s) |
[email protected]
|
| Organization name |
Université de Sherbrooke
|
| Department |
Anatomie et biologie cellulaire
|
| Street address |
3201 rue Jean-Mignault
|
| City |
Sherbrooke |
| State/province |
Quebec |
| ZIP/Postal code |
J1E 4K8 |
| Country |
Canada |
| |
|
| Platform ID |
GPL24676 |
| Series (1) |
| GSE125852 |
Effect of the twelve isoforms of Hepatocyte nuclear factor 4 alpha on HCT116 cell line transcriptome |
|
| Relations |
| BioSample |
SAMN10841208 |
| SRA |
SRX5307075 |
