 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 01, 2018 |
| Title |
RealSeq_Universal miRNA Reference Kit_1 ug |
| Sample type |
SRA |
| |
|
| Source name |
Agilent (750700)
|
| Organism |
Homo sapiens |
| Characteristics |
amount: 1 ug
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Libraries were prepared for 1 ug of Universal miRNA Reference Kit (Agilent) with the following protocols: TruSeq Small RNA, NEXTFlex Small RNA, QIASeq miRNA, and RealSeq-AC
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
Processed data file: Raw_counts_Universal_miRNA.csv
|
| Data processing |
Basecalling performed by Illumina RTA 1.18.54
Reads demultiplexed by NextSeq instrument
Reads trimmed of adapter with cutadapt with the following specifications: For TruSeq and RealSeq libraries: cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 15; For NEXTFlex libraries: cutadapt -u 4 -a NNNNTGGAATTCTCGGGTGCCAAGG -m 15; For QIASeq libraries: cutadapt -a AACTGTAGGCACCATCAAT -m 15
Trimmed reads were subsampled at random to 13 million reads per library
Subsampled reads were mapped to index with the complete YM500v3 database (PMID:27899625); by using bowtie2 with the following parameters: bowtie2 -L8 --local
Raw counts of reads were obtained from sam files, by using samtools and picard-tools
Supplementary_files_format_and_content: raw counts for all small RNAs on YM500v3 database
|
| |
|
| Submission date |
May 15, 2018 |
| Last update date |
Jul 01, 2018 |
| Contact name |
Sergio Barberan-Soler |
| E-mail(s) |
[email protected]
|
| Phone |
8314267700
|
| Organization name |
Somagenics Inc
|
| Street address |
2161 Delaware Avenue
|
| City |
Santa Cruz |
| State/province |
CA |
| ZIP/Postal code |
95060 |
| Country |
USA |
| |
|
| Platform ID |
GPL21697 |
| Series (1) |
| GSE107304 |
Increasing miRNA sequencing accuracy using an RNA circularization approach |
|
| Relations |
| BioSample |
SAMN09211360 |
| SRA |
SRX4085781 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
