|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Mar 30, 2018 |
Title |
HT29_2D2 |
Sample type |
SRA |
|
|
Source name |
Colorectal adenocarcinoma cell line HT29
|
Organism |
Homo sapiens |
Characteristics |
cell line: HT29 tissue: Colorectal adenocarcinoma cell line HT29 cell culture: 2D monolayer
|
Growth protocol |
For the monolayer (2D) culture, colorectal adenocarcinoma DLD1 (ATCC, Rockville, Maryland, USA) and HT29 (ATCC) cells were plated in 25 cm2 tissue culture flasks at cell densities of 35000 and 100000 cells, respectively. For multicellular spheroid culture, 7000 and 3500 cells, for DLD1 and HT29 cells, accordingly, were plated in 96 round-bottom well plates precoated with a layer of 1% agarose gel. DLD1 cells were cultured in RPMI (Gibco, Germany), meanwhile HT29 cells - in DMEM (Gibco) cell culture medium, which were supplemented with 10% fetal bovine serum (Gibco), 2mM glutamine (Gibco), 1mM sodium pyruvate (Gibco), 100 UI/mL penicillin (Sigma-Aldrich, USA) and 0.1 mg/mL streptomycin (Sigma-Aldrich). Cell cultures were maintained at 37°C in a humidified atmosphere containing 5% CO2. Total RNA was extracted from cells following 6 days of cell growth in 2D or 3D conditions.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated using MirVana miRNA isolation kit according to manufacturer's instructions. 2 μg of total RNA were used for the library construction using NEXTflex small RNA sequencing kit V3 (Bioo Scientific, USA) for DLD1 cells, and NEXTflex small RNA sequencing kit V2 for HT29 cells according to the manufacturer’s instructions.
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
HT29 2D cell culture replicate 2 Biological replicate 2 of 2. HT29 cells were cultivated under 2D monolayer forming growth conditions
|
Data processing |
Basecalls were performed and FASTQ files were generated using Casava pipeline version 1.8.3. Initial quality assessment was based on data passing the Illumina Chastity filtering. Subsequently, reads containing PhiX control signal were removed. Sequenced reads were trimmed for adaptor sequence (TGGAATTCTCGGGTGCCAAGG) using Cutadapt 1.11. Additionaly for DLD1, 4 random, miRNA sequence flanking nucleotides, that were introduced in library building process, were cut. Sequences that quality score was less than 25 and sequences shorter than 15 nt were excluded. Trimmed and filtered reads were aligned to human genome hg19 (UCSC) using bowtie2 2.1.0 using –end-to-end alignment Human genome aligned reads were further aligned to mirbase.org miRNA sequences (release 21) using bowtie2 2.1.0 using parameters --local -N 0 -L 16 miRNA mapped reads were counted and written to tab delimited abundance measurement text files. Abundance measurements were used for differential expression analysis using EdgeR package 3.4.2. First, abundance measurements containing miRNA counts were normalized using upper-quartile method. Secondly, fold changes of miRNA expression were calculated and miRNA with fold changes >1.5, p>0.05 and at least 10 miRNA counts per million were considered differentially expressed. Genome_build: hg19 (UCSC); miRBAse release 21 Supplementary_files_format_and_content: tab delimited text files contain abundance measurements of miRNAs that mapped to annotated miRNA sequences. Data are provided as miRNA IDs in first collumn and miRNA counts in second collumn.
|
|
|
Submission date |
Mar 29, 2018 |
Last update date |
Mar 30, 2018 |
Contact name |
Vaidotas Stankevicius |
E-mail(s) |
[email protected]
|
Phone |
+37068313680
|
Organization name |
National Cancer Institute
|
Lab |
Laboratory of molecullar oncology
|
Street address |
Santariskiu 1
|
City |
Vilnius |
State/province |
Lithuania |
ZIP/Postal code |
LT-08406 |
Country |
Lithuania |
|
|
Platform ID |
GPL16791 |
Series (1) |
GSE112492 |
Differential miRNA expression profiles of colorectal DLD1 and HT29 cell lines grown under 3D cell culture conditions |
|
Relations |
BioSample |
SAMN08813512 |
SRA |
SRX3862480 |
Supplementary file |
Size |
Download |
File type/resource |
GSM3071317_HT29_2D2_RAW_mirna_counts.txt.gz |
6.7 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
Processed data are available on Series record |
|
|
|
|
|