|
| Status |
Public on Dec 26, 2018 |
| Title |
Primate fetal hepatic response to maternal obesity [mnr_miRNA_seq_69] |
| Sample type |
SRA |
| |
|
| Source name |
Baboon fetal liver_obese mother
|
| Organism |
Papio hamadryas |
| Characteristics |
gender: female
condition: obese mother
tissue: fetal liver
developmental stage: near term fetus (0.9 gestation)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Qiagen miRNeasy Mini Kit according to manufacturer's protocol
Illumina Truseq Small RNA Sample Prep Kit according to manufacturer's protocol; 12 multiplexed samples pooled per lane with cBot v2 and GAIIX Truseq v5 36 SR flowcell
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
miRNA
MO 3
|
| Data processing |
Illumina Casava1.7 software used for basecalling.
Sequenced reads were trimmed for adaptor sequence, reads less than 18 bp were discarded, and reads were mapped to hg18 whole genome using miRDeep2 mapper.pl with parameters -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -q
Detection and quantification of known human miRbase 18 and novel miRNA species was performed using miRDeep2.pl
Raw read counts were normalized to reads per million (RPM)
Genome_build: hg18
Supplementary_files_format_and_content: Excel file with raw and normalized expression values and statistics. FASTA files with the hairpin and mature miRNA sequences for novel miRNAs are available on the series record.
|
| |
|
| Submission date |
Jun 06, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Sobha Puppala |
| E-mail(s) |
[email protected]
|
| Phone |
210-258-9770
|
| Organization name |
Texas Biomedical Research Institute
|
| Department |
Genetics
|
| Street address |
7620 NW Loop 410
|
| City |
San Antonio |
| State/province |
TX |
| ZIP/Postal code |
78227 |
| Country |
USA |
| |
|
| Platform ID |
GPL15440 |
| Series (2) |
| GSE99717 |
Primate fetal hepatic response to maternal obesity: epigenetic signaling pathways and lipid accumulation [miRNA-seq] |
| GSE99718 |
Primate fetal hepatic response to maternal obesity: epigenetic signaling pathways and lipid accumulation |
|
| Relations |
| BioSample |
SAMN07197344 |
| SRA |
SRX2885491 |
