|
| Status |
Public on Jun 30, 2017 |
| Title |
Estrogen+tamoxifen_2 |
| Sample type |
SRA |
| |
|
| Source name |
metastatic breast adenocarcinoma: pleural effusion
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: mammary gland/breast
tumor type: breast adenocarcinoma
treatment: Estrogen+tamoxifen
|
| Extracted molecule |
nuclear RNA |
| Extraction protocol |
5 ×10^6 nuclei were used for each run-on reaction, 2 biological replicates were produced for both vehicle and estrogen treatments. Br-UTP was incorporated into on-going transcription by run-on reaction which was performed at 30 degree for 5 min. Total RNA was extracted with TRIzol and fragmented with RNA Fragmentation Reagent. Fragmented RNA was purified with P-30 column, which was followed by T4 polynucleotide kinase treatment to dephosphorylate the 3’ end of RNA fragments. Br-UTP labeled RNA was enriched twice with anti-BrdU beads and precipitated overnight.
PolyA tailing was done using E.coli Poly(A) Polymerase, followed by reverse transcription with oNTI-223-index: /5Phos/GATCGTCGGACTGTAGAACTCTGAAC/iSp18/TCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTVN which allows custom barcoding. Exonuclease I was used to remove excess oligo after reverse transcription. DNA-RNA duplex was purified with ChIP DNA Clean & Concentrator Kit followed by RNAse H treatment. cDNA was circularized amplified with oNTI-201: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACG and oNTI-200: CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(XXXXXX is barcode used for specific sample) for 12 to 14 cycles. Final PCR product was purified by running 10% TBE gel and cleaned up.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
analyzeRNA_SX_noadj.txt
analyzeRNA_SX_rpkm.txt
|
| Data processing |
Library strategy: Gro-seq
Reads were first trimmed to remove 3´polyA with Homer 4.6
Trimmed reads were quality filtered with FASTX Toolkit 0.0.14 with options -v -q 10 -p 97 to have minimum 97% of reads with quality score greater than 10
Ribosome RNA reads were removed with Bowtie 1.12. Then filted reads were aligned to hg19 using Bowtie 1.12 with options v = 2, m = 3, k = 1.
Aligned files (sam files) were made into Tagdirectories with Homer 4.6. Raw reads counts calculated with analyzeRNA.pl command, option -noadj to specify raw counts. Normalized expression files were created also with analyzeRNA.pl command, with option -rpkm to specify the normalization.
Differential gene expression analysis was performed with edgeR 3.8.5
Genome_build: hg19
Supplementary_files_format_and_content: analyzeRNA_SX_noadj.txt tab-delimited text files include raw reads values for each sample, and analyzeRNA_SX_rpkm.txt tab-delimited text files include RPKM values for each sample.
|
| |
|
| Submission date |
May 31, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Shixiong Wang |
| E-mail(s) |
[email protected]
|
| Phone |
+47-22845865
|
| Organization name |
University of Oslo
|
| Department |
Centre for Molecular Medicine Norway
|
| Street address |
Gaustadalléen 21
|
| City |
Oslo |
| ZIP/Postal code |
0349 |
| Country |
Norway |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE99508 |
Genome wide analysis of the transcription induced by estrogen and tamoxifen in MCF-7 cells |
|
| Relations |
| BioSample |
SAMN07180817 |
| SRA |
SRX2873448 |
