|
| Status |
Public on Oct 01, 2015 |
| Title |
4F iTSC clone C |
| Sample type |
SRA |
| |
|
| Source name |
Reprogrammed MEF to TS clone
|
| Organism |
Mus musculus |
| Characteristics |
cell line: 4F iTSC clone C
condition: Reprogrammed MEF to TS clone
|
| Treatment protocol |
Doxycycline was added to induce expression of virally transduced transgenes in 4F MEFS to generate all 5 iTSC clones
|
| Growth protocol |
all cells were grown in standard 70% conditioned TS medium supplemented with heparin and bfgf
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA extracted according to standard protocols. DNA was used for MeDIP analysis as described previously (Senner et al., Stem Cells 2012).
Genomic DNA was fragmented by sonication (Diagenode Bioruptor), and adaptor ligated with paired-end adaptors 5’-PGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3’ and 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3’ (* Phosphorothioate group) and the NEBnext library preparation kit. Subsequently immunoprecipitaions with an anti-5-methylcytosine antibody were carried out in duplicate. IP duplicates –prepared for each sample – were pooled and MeDIP DNA libraries were column-purified (MinElute, Qiagen). MeDIP libraries were amplified by PCR for 12 cycles using distinct combinations of primers: PE 1.0 (Fw) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, and various iPCR tag (Rv) primers (Quail et al, 2012) Amplified MeDIP libraries were resolved by 2% agarose gel electrophoresis, and DNA fragments within the 300-500 nt range were cut out and DNA was purified using the Qiagen Gel extraction kit. 5mC immuno-precipitation efficiency was confirmed by analysing ES and TS cell MeDIP pre- and post-amplification libraries by quantitative PCR for candidate loci (Elf5, Nanog). Library concentration was determined using KAPA Illumina SYBR Universal Lid Q Kit (ANACHEM) and by Bioanalyzer.
|
| |
|
| Library strategy |
MeDIP-Seq |
| Library source |
genomic |
| Library selection |
5-methylcytidine antibody |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Genomic mapping of paired-end reads was performed with Bowtie2 (v2.2.3) using default parameters. Reads were mapped to the mouse genome build NCBIM37. Final data analysis was performed using SeqMonk software (www.bioinformatics.babraham.ac.uk/projects/seqmonk/).
Genome_build: NCBIM37
Quantitated MeDIP-Seq files were generated using SeqMonk (v0.28.0). Probes were designed over CpG islands (as defined by illingsworth, 2008), then quantified, correcting for total read number and Log2 converted. The result file carries descriptive column headers and is tab-delimited; the relevant columns are: (1) ID; (2) Chromosome; (3) Start; (4) End; (13-20) log2 read count per CGI
|
| |
|
| Submission date |
Dec 18, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Felix Krueger |
| E-mail(s) |
[email protected]
|
| Organization name |
Altos Labs
|
| Department |
Bioinformatics
|
| Street address |
Granta Park
|
| City |
Cambridge |
| ZIP/Postal code |
CB21 6GP |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE64339 |
Breaking the lineage barrier: Direct induction of trophoblast stem cells from murine fibroblasts |
|
| Relations |
| BioSample |
SAMN03268735 |
| SRA |
SRX817300 |
