|
| Status |
Public on Jan 13, 2014 |
| Title |
embryo_12-14h |
| Sample type |
SRA |
| |
|
| Source name |
whole embryo
|
| Organism |
Drosophila virilis |
| Characteristics |
developmental stage: 12-14 h embryo
genotype/variation: wild type
|
| Growth protocol |
D. virilis were maintained on standard fly media at 25°C. Embryos were collected on apple juice agar plates and allowed to age for the desired times.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Samples were disrupted in 1 ml Trizol (Invitrogen) and total RNA was extracted according to the manufacturer's instructions.
Librarires were constructed using the Illumina TruSeq™ Small RNA Kit
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Sample 7
small RNA profiling
|
| Data processing |
3' adapters (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC) were trimmed using the cutadapt tool with default parameters and reads shorter than 17 nt were discarded.
Reads mapping to known rRNAs (including the 2S rRNA), tRNAs and sn(o)RNAs were filtered out.
Filtered reads were mapped to the genome using Bowtie allowing 1 mismatch; reads mapping to more than 5 loci were discarded.
Different runs of the same sample were merged.
Genome_build: dvir_r1.2_FB2011_07
Supplementary_files_format_and_content: Tab-delimited tables (.txt) with small RNA counts
|
| |
|
| Submission date |
Jan 13, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Maria Ninova |
| E-mail(s) |
[email protected]
|
| Organization name |
Calfironia Institute of Technology
|
| Department |
Division of Biology and Biological Engineering
|
| Street address |
1200 E California Blvd
|
| City |
Pasadena |
| State/province |
CA |
| ZIP/Postal code |
91125 |
| Country |
USA |
| |
|
| Platform ID |
GPL13313 |
| Series (1) |
| GSE54009 |
Small RNA expression throughout the development of Drosophila virilis |
|
| Relations |
| BioSample |
SAMN02582442 |
| SRA |
SRX425476 |
