NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1305825 Query DataSets for GSM1305825
Status Public on Jan 13, 2014
Title embryo_12-14h
Sample type SRA
 
Source name whole embryo
Organism Drosophila virilis
Characteristics developmental stage: 12-14 h embryo
genotype/variation: wild type
Growth protocol D. virilis were maintained on standard fly media at 25°C. Embryos were collected on apple juice agar plates and allowed to age for the desired times.
Extracted molecule total RNA
Extraction protocol Samples were disrupted in 1 ml Trizol (Invitrogen) and total RNA was extracted according to the manufacturer's instructions.
Librarires were constructed using the Illumina TruSeq™ Small RNA Kit
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2000
 
Description Sample 7
small RNA profiling
Data processing 3' adapters (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC) were trimmed using the cutadapt tool with default parameters and reads shorter than 17 nt were discarded.
Reads mapping to known rRNAs (including the 2S rRNA), tRNAs and sn(o)RNAs were filtered out.
Filtered reads were mapped to the genome using Bowtie allowing 1 mismatch; reads mapping to more than 5 loci were discarded.
Different runs of the same sample were merged.
Genome_build: dvir_r1.2_FB2011_07
Supplementary_files_format_and_content: Tab-delimited tables (.txt) with small RNA counts
 
Submission date Jan 13, 2014
Last update date May 15, 2019
Contact name Maria Ninova
E-mail(s) [email protected]
Organization name Calfironia Institute of Technology
Department Division of Biology and Biological Engineering
Street address 1200 E California Blvd
City Pasadena
State/province CA
ZIP/Postal code 91125
Country USA
 
Platform ID GPL13313
Series (1)
GSE54009 Small RNA expression throughout the development of Drosophila virilis
Relations
BioSample SAMN02582442
SRA SRX425476

Supplementary file Size Download File type/resource
GSM1305825_sample_7.txt.gz 247.2 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap