 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 26, 2012 |
| Title |
DNA-seq from OSC |
| Sample type |
SRA |
| |
|
| Source name |
DNA-seq_OSC
|
| Organism |
Drosophila melanogaster |
| Characteristics |
genotype/variation: wild-type
tissue/cell type: Ovarian Somatic Cells (OSC)
molecule subtype: DNA
|
| Treatment protocol |
OSC were transfected twice with siRNAs and analyzed after 4 days
|
| Growth protocol |
flies were grown at 25 degrees; OSC were grown at 27 degrees on M3 medium
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
GRO-seq was done according to Core et al. 2008; ChIP-seq as described in Lee et al. 2006; RNA-seq as in Zhong et al. 2011
small-RNAs were cloned as described in Brennecke et al. 2007
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
small RNA-seq libraries: basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0); fastq files were adapter 'AGATCGGAAGAGCACACGTCT' clipped using cutadapt, version 1.0, default settings; after adapter removal, the first and last 4 bases were trimmed (both linkers contain 4 random nucleotides at their respective termini) from sequence as well using HomerTools, version 3.9.
small RNA-seq libraries: reads were mapped with bowtie v0.12.7 to D. mel. genome (dm3) and BigWig files were created with Samtools v 0.1.16 and BedTools v2.16.1
GRO-seq: basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0); fastq file was adapter' ATCGTATGCCGTCTTCTGCTTGT' clipped using cutadapt, version 1.0, default settings; after adapter removal, the first and last 4 bases were trimmed (both linkers contain 4 random nucleotides at their respective termini) from sequence as well using HomerTools, version 3.9.
GRO-seq: reads were mapped with bowtie v0.12.7 to D. mel. genome (dm3) and BigWig files were created with Samtools v 0.1.16 and BedTools v2.16.1
RNA-seq: basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0); fastq files containing 2nd mate were reverse complemented and used together with fastq files containing 1st mate as single-end library; N-containing reads were discarded; reads were trimmed to high-quality bases 6-56 using HomerTools, version 3.9 and mapped to genome and transcriptome using in-house developed pipeline.
ChIP-seq: basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0); reads were trimmed to bases 2-50 using HomerTools, version 3.9; N-containing reads were discarded; smaller than 50nt-long reads were discarded.
ChIP-seq: reads were mapped with bowtie v0.12.7 to D. mel. genome (dm3) and BigWig files were created with Samtools v 0.1.16 and BedTools v2.16.1
DNA-seq: basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0); N-containing reads were discarded; smaller than 100nt-long reads were discarded; TEs insertions were called using in-house developed pipeline.
Supplementary_files_format_and_content: DNA-seq: file contains coordinates of TEs insertions called in OSC
Supplementary_files_format_and_content: RNA-seq, GRO-seq, ChIP-seq: file contains density coverage of uniquely mapped reads to dm3
Genome_build: dmel_release 5
|
| |
|
| Submission date |
Oct 29, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Grzegorz Sienski |
| E-mail(s) |
[email protected]
|
| Organization name |
IMBA-Institute of Molecular Biotechnology of Austrian Academy of Sciences
|
| Street address |
Dr. Bohr-Gasse 3
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE41729 |
Transcriptional silencing of transposable elements by Piwi and its impact on chromatin and gene expression |
|
| Relations |
| SRA |
SRX201874 |
| BioSample |
SAMN01797295 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1027402_TE_insertions.bed.gz |
31.8 Kb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
