U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination
    • Showing Current items.

    mir-45 [ Caenorhabditis elegans ]

    Gene ID: 260196, updated on 4-Jan-2025

    Summary

    Official Symbol
    mir-45
    Primary source
    WormBase:WBGene00003273
    Locus tag
    CELE_ZK930.11
    See related
    AllianceGenome:WB:WBGene00003273
    Gene type
    ncRNA
    Organism
    Caenorhabditis elegans (strain: Bristol N2)
    Lineage
    Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis
    Summary
    Is expressed in head muscle; head neurons; intestine; and pharynx. [provided by Alliance of Genome Resources, Jan 2025]
    NEW
    Try the new Gene table
    Try the new Transcript table

    Genomic context

    See mir-45 in Genome Data Viewer
    Location:
    chromosome: II
    Exon count:
    1
    Sequence:
    Chromosome: II; NC_003280.10 (11880944..11881039, complement)

    Chromosome II - NC_003280.10Genomic Context describing neighboring genes Neighboring gene DNA topoisomerase 2 top-2 Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene pseudo Neighboring gene Lon proteolytic domain-containing protein

    General gene information

    Expression pattern

    • This gene is expressed at high level at all stages, embryos, larvae from the L1 to the L4 stage, and adult, especially in the soma: indeed, the micro RNA is expressed at higher level in glp-4 adults, which almost lack a germ line, than in wild type adults, which have a large germ line [Lau and Bartel annotation]

    Molecular properties

    • [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
    • [Wormbase] mir-45 encodes a microRNA, a small non-protein coding RNA and is conserved in C. briggsae\; the last miRNA of the 42-mir-44 cluster of miRNAs is also represented by mir-45 which is not part of the cluster\; mir-45 is expressed at all life stages\; many of the known microRNAs are involved in post-transcriptional regulation of genes\; the precise function of mir-45 is not known.
    • [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UGACUAGAGACACAUUCAGCU originates from the 3' end of the stem-loop sequence CACCATGTGCCACGCTGGATGTGCTCGTTAGTCATAATATCCTCCACAAAGCAAGGACTATGACTAGAGACACATTCAGCTTGGCGCCGAATGCAT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).

    NCBI Reference Sequences (RefSeq)

    NEW Try the new Transcript table

    Genome Annotation

    The following sections contain reference sequences that belong to a specific genome build. Explain

    Reference assembly

    Genomic

    1. NC_003280.10 Reference assembly

      Range
      11880944..11881039 complement
      Download
      GenBank, FASTA, Sequence Viewer (Graphics)

    RNA

    1. NR_000931.2 RNA Sequence

      Status: REVIEWED