Expression pattern

• This gene is expressed at high level at all stages, embryos, larvae from the L1 to the L4 stage, and adult, especially in the soma: indeed, the micro RNA is expressed at higher level in glp-4 adults, which almost lack a germ line, than in wild type adults, which have a large germ line [Lau and Bartel annotation]

Molecular properties

• [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
• [Wormbase] mir-45 encodes a microRNA, a small non-protein coding RNA and is conserved in C. briggsae\; the last miRNA of the 42-mir-44 cluster of miRNAs is also represented by mir-45 which is not part of the cluster\; mir-45 is expressed at all life stages\; many of the known microRNAs are involved in post-transcriptional regulation of genes\; the precise function of mir-45 is not known.
• [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UGACUAGAGACACAUUCAGCU originates from the 3' end of the stem-loop sequence CACCATGTGCCACGCTGGATGTGCTCGTTAGTCATAATATCCTCCACAAAGCAAGGACTATGACTAGAGACACATTCAGCTTGGCGCCGAATGCAT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).