U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

mir-58.1 [ Caenorhabditis elegans ]

Gene ID: 260181, updated on 4-Jan-2025

Summary

Official Symbol
mir-58.1
Primary source
WormBase:WBGene00003286
Locus tag
CELE_Y67D8A.4
See related
AllianceGenome:WB:WBGene00003286
Gene type
ncRNA
Organism
Caenorhabditis elegans (strain: Bristol N2)
Lineage
Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis
Summary
Is expressed in several structures, including excretory cell; hypodermis; intestine; pharynx; and spermatheca. [provided by Alliance of Genome Resources, Jan 2025]
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

See mir-58.1 in Genome Data Viewer
Location:
chromosome: IV
Exon count:
1
Sequence:
Chromosome: IV; NC_003282.8 (3233254..3233350)

Chromosome IV - NC_003282.8Genomic Context describing neighboring genes Neighboring gene FHA domain-containing protein Neighboring gene ncRNA Neighboring gene Phosphorylase b kinase regulatory subunit Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene DM domain-containing protein

Bibliography

GeneRIFs: Gene References Into Functions

What's a GeneRIF?

Interactions

Products Interactant Other Gene Complex Source Pubs Description

General gene information

Expression pattern

  • This gene is expressed at high level at all stages of development, embryos, L1, L2, L3, L4 larvae and aduts\; it is expressed at least in the soma, since the transcript is also found in large amounts in germ-line defective glp-4 animals [reviewed by Bartel D, Lau N, Lim L, oct 2003]

Molecular properties

  • [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
  • [Wormbase] mir-58 encodes a microRNA, a small non-protein coding RNA and is conserved in C. briggsae\; mir-58 is expressed constitutively throughout development in normal worms and in glp-4(bn2) adults\; many of the known microRNAs are involved in post-transcriptional regulation of genes\; the precise function of mir-58 is not known.
  • [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UGAGAUCGUUCAGUACGGCAAU originates from the 3' end of the stem-loop sequence GCTCGTCATATCCATTGCCCTACTCTTCGCATCTCATCACTTCGTCCAATACCATAGGGATGAGATCGTTCAGTACGGCAATGGACTGAGCTAGAGT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).

NCBI Reference Sequences (RefSeq)

NEW Try the new Transcript table

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NC_003282.8 Reference assembly

    Range
    3233254..3233350
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

RNA

  1. NR_000454.2 RNA Sequence

    Status: REVIEWED