ClinVar for Gene (Select 4705) - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 100 of 452

<< First< Prev

Page of 5

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3379442	NM_004544.4(NDUFA10):c.251A>G (p.Lys84Arg)	NDUFA10 (K84R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 3373298	NM_004544.4(NDUFA10):c.589G>A (p.Asp197Asn)	NDUFA10 (D197N)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 3364853	NM_004544.4(NDUFA10):c.670-3T>A	NDUFA10	Single nucleotide variant (non-coding transcript variant +1 more)	not provided	GUncertain significance
Select item 3359400	NM_004544.4(NDUFA10):c.539G>A (p.Arg180Gln)	NDUFA10 (R180Q)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 3299018	NM_004544.4(NDUFA10):c.80G>C (p.Gly27Ala)	NDUFA10 (G27A)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 3299016	NM_004544.4(NDUFA10):c.538C>G (p.Arg180Gly)	NDUFA10 (R180G)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 3247415	NC_000002.11:g.(?_237481970)_(242801596_?)del	ACKR3, AGXT +55 more	Deletion	Bethlem myopathy 1A	GPathogenic
Select item 3242308	GRCh37/hg19 2q37.2-37.3(chr2:236478472-243048854)x1	ACKR3, AGAP1 +60 more	Copy number loss	not provided	GPathogenic
Select item 3233685	NM_004544.4(NDUFA10):c.76-1_86del	NDUFA10	Deletion (splice acceptor variant)	not specified	GUncertain significance
Select item 3186970	NM_004544.4(NDUFA10):c.858_862dup (p.Asn288fs)	NDUFA10 (N288fs)	Duplication (frameshift variant +1 more)	Inborn genetic diseases	GPathogenic
Select item 3186951	NM_004544.4(NDUFA10):c.319G>A (p.Asp107Asn)	NDUFA10 (D107N)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 3186938	NM_004544.4(NDUFA10):c.109C>T (p.Arg37Cys)	NDUFA10 (R37C)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 3148939	GRCh37/hg19 2q35-37.3(chr2:216815496-242782258)x3	AAMP, ABCB6 +218 more	Copy number gain	See cases	GPathogenic
Select item 3148872	GRCh37/hg19 2q37.3(chr2:239671606-242782258)x1	AGXT, ANKMY1 +35 more	Copy number loss	See cases	GPathogenic
Select item 3148868	GRCh37/hg19 2q37.1-37.3(chr2:235267074-242782258)x1	ACKR3, AGAP1 +60 more	Copy number loss	See cases	GPathogenic
Select item 3068039	NM_004544.4(NDUFA10):c.844C>T (p.Pro282Ser)	NDUFA10 (P282S)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 3062615	GRCh37/hg19 2q37.2-37.3(chr2:236057846-242783384)x1	ACKR3, AGAP1 +58 more	Copy number loss	not specified	GPathogenic
Select item 3062606	GRCh37/hg19 2q37.2-37.3(chr2:236726690-242783384)x1	ACKR3, AGAP1 +58 more	Copy number loss	not specified	GPathogenic
Select item 3046462	NM_004544.4(NDUFA10):c.75+10C>G	NDUFA10	Single nucleotide variant (intron variant)	NDUFA10-related disorder	GLikely benign
Select item 3026392	NM_004544.4(NDUFA10):c.*2110C>T	NDUFA10	Single nucleotide variant (3 prime UTR variant +1 more)	not provided	GLikely benign
Select item 3003553	NM_004544.4(NDUFA10):c.66C>T (p.Ala22=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2996599	NM_004544.4(NDUFA10):c.890+8C>T	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2961253	NM_004544.4(NDUFA10):c.564C>T (p.Asn188=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2889745	NM_004544.4(NDUFA10):c.621C>T (p.Ile207=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2880361	NM_004544.4(NDUFA10):c.890+15G>A	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2816432	NM_004544.4(NDUFA10):c.12G>A (p.Arg4=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2784168	NM_004544.4(NDUFA10):c.245-8C>A	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2726374	NM_004544.4(NDUFA10):c.890+17G>C	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2715502	NM_004544.4(NDUFA10):c.753A>G (p.Glu251=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2685886	GRCh37/hg19 2q37.3(chr2:240827284-241048926)x3	NDUFA10, OR6B2 +2 more	Copy number gain	not provided	GUncertain significance
Select item 2685875	GRCh37/hg19 2q35-37.3(chr2:218376403-242783384)x3	AAMP, ABCB6 +208 more	Copy number gain	not provided	GPathogenic
Select item 2684986	GRCh37/hg19 2q37.3(chr2:238460671-242783384)x1	AQP12A, AGXT +51 more	Copy number loss	not provided	GPathogenic
Select item 2671953	NM_004544.4(NDUFA10):c.1000-12409C>G	NDUFA10 (R356G)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2671932	NM_004544.4(NDUFA10):c.1000-12367C>G	NDUFA10 (R370G)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2671587	Single allele	CHRND, LRRFIP1 +123 more	Duplication	not provided	GPathogenic
Select item 2663096	NM_004544.4(NDUFA10):c.29C>G (p.Ala10Gly)	NDUFA10 (A10G)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2652083	NM_004544.4(NDUFA10):c.999+6452C>T	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2652082	NR_136158.2(NDUFA10):n.4373A>G	NDUFA10	Single nucleotide variant (non-coding transcript variant)	not provided	GBenign
Select item 2622315	NM_004544.4(NDUFA10):c.357T>A (p.Asp119Glu)	NDUFA10 (D119E)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2620295	NM_004544.4(NDUFA10):c.801A>C (p.Lys267Asn)	NDUFA10 (K267N)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2606171	NM_004544.4(NDUFA10):c.259C>G (p.Pro87Ala)	NDUFA10 (P87A)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2577650	NM_004544.4(NDUFA10):c.415C>T (p.Arg139Cys)	NDUFA10 (R139C)	Single nucleotide variant (missense variant +1 more)	not provided	GLikely pathogenic
Select item 2538431	NM_004544.4(NDUFA10):c.237G>T (p.Glu79Asp)	NDUFA10 (E79D)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2504715	NM_004544.4(NDUFA10):c.577G>A (p.Val193Ile)	NDUFA10 (V193I)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2499727	NM_004544.4(NDUFA10):c.444G>C (p.Glu148Asp)	NDUFA10 (E148D)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2434080	NM_004544.4(NDUFA10):c.1025_1026insATGG (p.Tyr343fs)	NDUFA10 (G306fs +1 more)	Insertion (frameshift variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2425085	NC_000002.11:g.(?_236403331)_(242801596_?)del	ANO7, ACKR3 +59 more	Deletion	Bethlem myopathy 1A	GPathogenic
Select item 2413144	NM_004544.4(NDUFA10):c.557A>C (p.His186Pro)	NDUFA10 (H186P)	Single nucleotide variant (missense variant +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 2338751	NM_004544.4(NDUFA10):c.1058G>C (p.Trp353Ser)	NDUFA10 (W353S +1 more)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2297697	NM_004544.4(NDUFA10):c.137G>C (p.Gly46Ala)	NDUFA10 (G46A)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2295010	NM_004544.4(NDUFA10):c.831G>T (p.Lys277Asn)	NDUFA10 (K277N)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2268339	NM_004544.4(NDUFA10):c.527A>T (p.Gln176Leu)	NDUFA10 (Q176L)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2230576	NM_004544.4(NDUFA10):c.722A>G (p.Tyr241Cys)	NDUFA10 (Y241C)	Single nucleotide variant (missense variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2183374	NM_004544.4(NDUFA10):c.856C>G (p.Gln286Glu)	NDUFA10 (Q286E)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2182190	NM_004544.4(NDUFA10):c.674A>G (p.His225Arg)	NDUFA10 (H225R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2111643	NM_004544.4(NDUFA10):c.450G>C (p.Leu150Phe)	NDUFA10 (L150F)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2110569	NM_004544.4(NDUFA10):c.23dup (p.Ala9fs)	NDUFA10 (A9fs)	Duplication (frameshift variant +1 more)	not provided	GUncertain significance
Select item 2065076	NM_004544.4(NDUFA10):c.475T>C (p.Leu159=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2063752	NM_004544.4(NDUFA10):c.75+17G>A	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2061077	NM_004544.4(NDUFA10):c.601C>G (p.Pro201Ala)	NDUFA10 (P201A)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2056673	NM_004544.4(NDUFA10):c.482G>A (p.Arg161His)	NDUFA10 (R161H)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2045684	NM_004544.4(NDUFA10):c.266C>T (p.Ala89Val)	NDUFA10 (A89V)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2045423	NM_004544.4(NDUFA10):c.599C>T (p.Pro200Leu)	NDUFA10 (P200L)	Single nucleotide variant (missense variant +1 more)	not provided +1 more	GUncertain significance
Select item 2037035	NM_004544.4(NDUFA10):c.309C>T (p.Pro103=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 2014326	NM_004544.4(NDUFA10):c.91A>C (p.Ser31Arg)	NDUFA10 (S31R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2011969	NM_004544.4(NDUFA10):c.1049A>T (p.Lys350Met)	NDUFA10 (K350M +1 more)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2006833	NM_004544.4(NDUFA10):c.136G>A (p.Gly46Arg)	NDUFA10 (G46R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2006727	NM_004544.4(NDUFA10):c.749+8A>G	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1993440	NM_004544.4(NDUFA10):c.547+7C>G	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1975711	NM_004544.4(NDUFA10):c.891-16G>A	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1967369	NM_004544.4(NDUFA10):c.76-14T>C	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1962861	NM_004544.4(NDUFA10):c.878_879inv (p.His293Arg)	NDUFA10 (H293R)	Inversion (missense variant +1 more)	not provided	GUncertain significance
Select item 1951413	NM_004544.4(NDUFA10):c.110G>A (p.Arg37His)	NDUFA10 (R37H)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1930121	NM_004544.4(NDUFA10):c.804+19A>T	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1927750	NM_004544.4(NDUFA10):c.669+16A>G	NDUFA10	Single nucleotide variant (non-coding transcript variant +1 more)	not provided	GLikely benign
Select item 1923570	NM_004544.4(NDUFA10):c.565G>A (p.Glu189Lys)	NDUFA10 (E189K)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1919183	NM_004544.4(NDUFA10):c.1009C>T (p.Arg337Cys)	NDUFA10 (R337C)	Single nucleotide variant (synonymous variant +2 more)	not provided	GUncertain significance
Select item 1911755	NM_004544.4(NDUFA10):c.977G>A (p.Arg326His)	NDUFA10 (R326H)	Single nucleotide variant (missense variant +2 more)	not provided	GUncertain significance
Select item 1910380	NM_004544.4(NDUFA10):c.804+17A>G	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1909047	NM_004544.4(NDUFA10):c.794A>G (p.Asp265Gly)	NDUFA10 (D265G)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1904317	NM_004544.4(NDUFA10):c.884G>A (p.Arg295Gln)	NDUFA10 (R295Q)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1900475	NM_004544.4(NDUFA10):c.804+18A>G	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1899188	NM_004544.4(NDUFA10):c.788C>G (p.Ala263Gly)	NDUFA10 (A263G)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1899003	NM_004544.4(NDUFA10):c.371A>G (p.Asn124Ser)	NDUFA10 (N124S)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1808622	GRCh37/hg19 2q37.2-37.3(chr2:236878509-242783384)x1	ACKR3, AGAP1 +59 more	Copy number loss	not provided	GPathogenic
Select item 1807819	GRCh37/hg19 2q37.2-37.3(chr2:235942616-242783384)x1	ACKR3, AGAP1 +60 more	Copy number loss	not provided	GPathogenic
Select item 1806358	NM_004544.4(NDUFA10):c.1000-12427TCCCTCCTTGAAGCTGATCGT[2]	NDUFA10	Microsatellite (inframe_deletion +1 more)	Mitochondrial complex 1 deficiency, nuclear type 22	GUncertain significance
Select item 1801470	NC_000002.12:g.239925792_239928083del	NDUFA10	Deletion (genic downstream transcript variant)	Schizophrenia	GUncertain significance
Select item 1801460	NC_000002.12:g.239921648_239921688del	NDUFA10	Deletion (genic downstream transcript variant)	Schizophrenia	GUncertain significance
Select item 1718918	NM_004544.4(NDUFA10):c.17T>G (p.Leu6Arg)	NDUFA10 (L6R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1715517	NM_004544.4(NDUFA10):c.341T>G (p.Leu114Trp)	NDUFA10 (L114W)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1714031	NM_004544.4(NDUFA10):c.98A>G (p.Gln33Arg)	NDUFA10 (Q33R)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 1711534	GRCh37/hg19 2q37.3(chr2:239229304-243199373)x1	AGXT, ANKMY1 +39 more	Copy number loss	not provided	GPathogenic
Select item 1703652	GRCh37/hg19 2q37.2-37.3(chr2:236472789-242783384)	HES6, ILKAP +58 more	Copy number loss	Chromosome 2q37 deletion syndrome	GPathogenic
Select item 1703651	GRCh37/hg19 2q37.1-37.3(chr2:233227837-242783384)	CHRND, CHRNG +93 more	Copy number loss	Chromosome 2q37 deletion syndrome	GPathogenic
Select item 1703543	GRCh37/hg19 2p25.3-q37.3(chr2:1-243199373)	ABCA12, ABCB11 +1216 more	Copy number gain	Mosaic trisomy 2	GPathogenic
Select item 1690800	NM_004544.4(NDUFA10):c.76-2A>G	NDUFA10	Single nucleotide variant (splice acceptor variant)	See cases +1 more	GConflicting classifications of pathogenicity
Select item 1684635	Single allele	LOC122889013, LOC122889014 +274 more	Deletion	Chromosome 2q37 deletion syndrome	GPathogenic
Select item 1675848	NM_004544.4(NDUFA10):c.834C>T (p.Phe278=)	NDUFA10	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely benign
Select item 1675847	NM_004544.4(NDUFA10):c.999+6365T>C	NDUFA10	Single nucleotide variant (intron variant)	not provided	GLikely benign

<< First< Prev

Page of 5