VCV000066694.2 - ClinVar

NM_006158.5(NEFL):c.48_60dup (p.Thr21fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(3)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Conflicting classifications of pathogenicity
Pathogenic(1); Uncertain significance(1)

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_006158.5(NEFL):c.48_60dup (p.Thr21fs)

Variation ID: 66694 Accession: VCV000066694.2

Type and length

Duplication, 13 bp

Location

Cytogenetic: 8p21.2 8: 24956455-24956456 (GRCh38) [ NCBI UCSC ] 8: 24813969-24813970 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Oct 20, 2013	Jul 29, 2019	May 1, 2006

HGVS

Nucleotide	Protein	Molecular consequence
NM_006158.5:c.48_60dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_006149.2:p.Thr21fs	frameshift
NC_000008.11:g.24956457_24956469dup
NC_000008.10:g.24813971_24813983dup
NG_008492.1:g.5150_5162dup
LRG_259:g.5150_5162dup

... more HGVS ... less HGVS

Protein change

T21fs

Other names

Canonical SPDI

NC_000008.11:24956455:CTCCACGTAGCGCC:CTCCACGTAGCGCCTCCACGTAGCGCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA217561 OMIM: 162280.0005 dbSNP: rs58640772 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
NEFL		No evidence available	No evidence available	GRCh38 GRCh37	576	713

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Charcot-Marie-Tooth disease type 2E	Pathogenic (1)	no assertion criteria provided	May 1, 2006	RCV000015077.22
not provided	not provided (1)	no classification provided	-	RCV000057141.1
Charcot-Marie-Tooth disease	Uncertain significance (1)	no assertion criteria provided	-	RCV000790245.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (May 01, 2006)	no assertion criteria provided Method: literature only	CHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2E Affected status: not provided Allele origin: germline	OMIM Accession: SCV000035333.3 First in ClinVar: Apr 04, 2013 Last updated: Oct 11, 2015	Publications: PubMed (1) PubMed: 16619203 Comment on evidence: In a 71-year-old man with Charcot-Marie-Tooth disease type 2E (CMT2E; 607684), Leung et al. (2006) identified a heterozygous 13-bp duplication/insertion at nucleotide 61 in exon … (more) In a 71-year-old man with Charcot-Marie-Tooth disease type 2E (CMT2E; 607684), Leung et al. (2006) identified a heterozygous 13-bp duplication/insertion at nucleotide 61 in exon 1 of the NEFL gene, predicted to result in termination at codon 21. Transient transfection experiments showed that the mutated NEFL could not form filaments by itself, and in the presence of mutated NEFL, wildtype NEFL formed only short filaments and alpha-internexin (605338) filaments collapsed into aggregates. (less)
Uncertain significance (-)	no assertion criteria provided Method: literature only	Charcot-Marie-Tooth disease Affected status: yes Allele origin: germline	Inherited Neuropathy Consortium Accession: SCV000929641.1 First in ClinVar: Jul 29, 2019 Last updated: Jul 29, 2019	Publications: PubMed (1) PubMed: 16619203
not provided (-)	no classification provided Method: not provided	not provided Affected status: not provided Allele origin: not provided	Epithelial Biology; Institute of Medical Biology, Singapore Accession: SCV000088254.1 First in ClinVar: Oct 20, 2013 Last updated: Oct 20, 2013

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
A novel duplication/insertion mutation of NEFL in a patient with Charcot-Marie-Tooth disease.	Leung CL	American journal of medical genetics. Part A	2006	PMID: 16619203

Text-mined citations for rs58640772 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 25, 2022

ClinVar Genomic variation as it relates to human health

NM_006158.5(NEFL):c.48_60dup (p.Thr21fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs58640772 ...