VCV000005683.2 - ClinVar

NM_005138.3(SCO2):c.179_188dup (p.Ile63fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

no assertion criteria provided

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_005138.3(SCO2):c.179_188dup (p.Ile63fs)

Variation ID: 5683 Accession: VCV000005683.2

Type and length

Duplication, 10 bp

Location

Cytogenetic: 22q13.33 22: 50524223-50524224 (GRCh38) [ NCBI UCSC ] 22: 50962652-50962653 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 3, 2020	Aug 3, 2020	May 1, 2002

HGVS

Nucleotide	Protein	Molecular consequence
NM_005138.3:c.179_188dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_005129.2:p.Ile63fs	frameshift
NM_152299.4:c.849_858dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		3 prime UTR
NM_001169109.2:c.179_188dup	NP_001162580.1:p.Ile63fs	frameshift
NM_001169110.1:c.179_188dup	NP_001162581.1:p.Ile63fs	frameshift
NM_001169111.2:c.179_188dup	NP_001162582.1:p.Ile63fs	frameshift
NM_001185011.2:c.849_858dup		3 prime UTR
NC_000022.11:g.50524224_50524233dup
NC_000022.10:g.50962653_50962662dup
NG_011860.1:g.10853_10862dup
NG_016235.1:g.7207_7216dup
NG_021419.1:g.21009_21018dup
LRG_727:g.10853_10862dup

... more HGVS ... less HGVS

Protein change

I63fs

Other names

Canonical SPDI

NC_000022.11:50524223:ATCAGCAGCC:ATCAGCAGCCATCAGCAGCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Trans-Omics for Precision Medicine (TOPMed) 0.00000

Links

OMIM: 604272.0006 dbSNP: rs1467767014 VarSome

Comment on variant

NCBI staff established an HGVS expression for this duplication based on Figure 2 of the paper by Salviati et al., 2002 (PubMed 12020273).

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
NCAPH2		-	-	GRCh38 GRCh37	53	573
SCO2		-	-	GRCh38 GRCh37	4	884

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1	Pathogenic (1)	no assertion criteria provided	May 1, 2002	RCV000006037.4

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (May 01, 2002)	no assertion criteria provided Method: literature only	MITOCHONDRIAL COMPLEX IV DEFICIENCY, NUCLEAR TYPE 2 Affected status: not provided Allele origin: germline	OMIM Accession: SCV000026219.3 First in ClinVar: Apr 04, 2013 Last updated: Aug 03, 2020	Publications: PubMed (1) PubMed: 12020273 Comment on evidence: For discussion of the 10-bp duplication (c.1302_1311dup) in the SCO2 gene that was found in compound heterozygous state in a patient with mitochondrial complex IV … (more) For discussion of the 10-bp duplication (c.1302_1311dup) in the SCO2 gene that was found in compound heterozygous state in a patient with mitochondrial complex IV deficiency nuclear type 2 (MC4DN2; 604377) by Salviati et al. (2002), see 604272.0002. (less)

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Cytochrome c oxidase deficiency due to a novel SCO2 mutation mimics Werdnig-Hoffmann disease.	Salviati L	Archives of neurology	2002	PMID: 12020273

Text-mined citations for rs1467767014 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 01, 2024

ClinVar Genomic variation as it relates to human health

NM_005138.3(SCO2):c.179_188dup (p.Ile63fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1467767014 ...