VCV000557671.1 - ClinVar

NM_017777.4(MKS1):c.1434_1462del (p.Arg479fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_017777.4(MKS1):c.1434_1462del (p.Arg479fs)

Variation ID: 557671 Accession: VCV000557671.1

Type and length

Deletion, 29 bp

Location

Cytogenetic: 17q22 17: 58206493-58206521 (GRCh38) [ NCBI UCSC ] 17: 56283854-56283882 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 5, 2018	Aug 5, 2018	Apr 12, 2018

HGVS

Nucleotide	Protein	Molecular consequence
NM_017777.4:c.1434_1462del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_060247.2:p.Arg479fs	frameshift
NM_001321268.2:c.825_853del	NP_001308197.1:p.Arg276fs	frameshift
NM_001321269.2:c.1408-141_1408-113del		intron variant
NM_001330397.2:c.1274-141_1274-113del		intron variant
NM_017777.3:c.1434_1462del29
NC_000017.11:g.58206495_58206523del
NC_000017.10:g.56283856_56283884del
NG_013020.1:g.18768_18796del
NG_013032.1:g.18085_18113del
LRG_687:g.18085_18113del

... more HGVS ... less HGVS

Protein change

R276fs, R479fs

Other names

Canonical SPDI

NC_000017.11:58206492:AGGTGACAGTGCCTGTGGTCTCTGTGCGGAG:AG

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

dbSNP: rs1555596845 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
MKS1		-	-	GRCh38 GRCh37	980	1067

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Bardet-Biedl syndrome 13 Joubert syndrome 28 Meckel syndrome, type 1	Likely pathogenic (1)	criteria provided, single submitter	Apr 12, 2018	RCV000673842.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Apr 12, 2018)	criteria provided, single submitter (Counsyl Autosomal Recessive and X-Linked Classification Criteria (2018)) Method: clinical testing	Meckel syndrome, type 1 Bardet-Biedl syndrome 13 Joubert syndrome 28 Affected status: unknown Allele origin: unknown	Counsyl Accession: SCV000799090.1 First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for germline classification of this variant

There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar.

Text-mined citations for rs1555596845 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Apr 25, 2022

ClinVar Genomic variation as it relates to human health

NM_017777.4(MKS1):c.1434_1462del (p.Arg479fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs1555596845 ...