Variant allele predicted to encode a truncated non-functional protein.
ClinVar Genomic variation as it relates to human health
NM_007294.4(BRCA1):c.815_824dup (p.Thr276fs)
Germline
Top reviewed classifications are shown here.
Submission summary:
Reviewed by expert panel
Pathogenic
Oct 2016 by
Evidence-based…
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_007294.4(BRCA1):c.815_824dup (p.Thr276fs)
Variation ID: 55723 Accession: VCV000055723.44
- Type and length
-
Duplication, 10 bp
- Location
-
Cytogenetic: 17q21.31 17: 43094706-43094707 (GRCh38) [ NCBI UCSC ] 17: 41246723-41246724 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Apr 4, 2013 Oct 20, 2024 Oct 18, 2016 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_007294.4:c.815_824dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_009225.1:p.Thr276fs frameshift NM_001407571.1:c.602_611dup NP_001394500.1:p.Thr205fs frameshift NM_001407581.1:c.815_824dup NP_001394510.1:p.Thr276fs frameshift NM_001407582.1:c.815_824dup NP_001394511.1:p.Thr276fs frameshift NM_001407583.1:c.815_824dup NP_001394512.1:p.Thr276fs frameshift NM_001407585.1:c.815_824dup NP_001394514.1:p.Thr276fs frameshift NM_001407587.1:c.812_821dup NP_001394516.1:p.Thr275fs frameshift NM_001407590.1:c.812_821dup NP_001394519.1:p.Thr275fs frameshift NM_001407591.1:c.812_821dup NP_001394520.1:p.Thr275fs frameshift NM_001407593.1:c.815_824dup NP_001394522.1:p.Thr276fs frameshift NM_001407594.1:c.815_824dup NP_001394523.1:p.Thr276fs frameshift NM_001407596.1:c.815_824dup NP_001394525.1:p.Thr276fs frameshift NM_001407597.1:c.815_824dup NP_001394526.1:p.Thr276fs frameshift NM_001407598.1:c.815_824dup NP_001394527.1:p.Thr276fs frameshift NM_001407602.1:c.815_824dup NP_001394531.1:p.Thr276fs frameshift NM_001407603.1:c.815_824dup NP_001394532.1:p.Thr276fs frameshift NM_001407605.1:c.815_824dup NP_001394534.1:p.Thr276fs frameshift NM_001407610.1:c.812_821dup NP_001394539.1:p.Thr275fs frameshift NM_001407611.1:c.812_821dup NP_001394540.1:p.Thr275fs frameshift NM_001407612.1:c.812_821dup NP_001394541.1:p.Thr275fs frameshift NM_001407613.1:c.812_821dup NP_001394542.1:p.Thr275fs frameshift NM_001407614.1:c.812_821dup NP_001394543.1:p.Thr275fs frameshift NM_001407615.1:c.812_821dup NP_001394544.1:p.Thr275fs frameshift NM_001407616.1:c.815_824dup NP_001394545.1:p.Thr276fs frameshift NM_001407617.1:c.815_824dup NP_001394546.1:p.Thr276fs frameshift NM_001407618.1:c.815_824dup NP_001394547.1:p.Thr276fs frameshift NM_001407619.1:c.815_824dup NP_001394548.1:p.Thr276fs frameshift NM_001407620.1:c.815_824dup NP_001394549.1:p.Thr276fs frameshift NM_001407621.1:c.815_824dup NP_001394550.1:p.Thr276fs frameshift NM_001407622.1:c.815_824dup NP_001394551.1:p.Thr276fs frameshift NM_001407623.1:c.815_824dup NP_001394552.1:p.Thr276fs frameshift NM_001407624.1:c.815_824dup NP_001394553.1:p.Thr276fs frameshift NM_001407625.1:c.815_824dup NP_001394554.1:p.Thr276fs frameshift NM_001407626.1:c.815_824dup NP_001394555.1:p.Thr276fs frameshift NM_001407627.1:c.812_821dup NP_001394556.1:p.Thr275fs frameshift NM_001407628.1:c.812_821dup NP_001394557.1:p.Thr275fs frameshift NM_001407629.1:c.812_821dup NP_001394558.1:p.Thr275fs frameshift NM_001407630.1:c.812_821dup NP_001394559.1:p.Thr275fs frameshift NM_001407631.1:c.812_821dup NP_001394560.1:p.Thr275fs frameshift NM_001407632.1:c.812_821dup NP_001394561.1:p.Thr275fs frameshift NM_001407633.1:c.812_821dup NP_001394562.1:p.Thr275fs frameshift NM_001407634.1:c.812_821dup NP_001394563.1:p.Thr275fs frameshift NM_001407635.1:c.812_821dup NP_001394564.1:p.Thr275fs frameshift NM_001407636.1:c.812_821dup NP_001394565.1:p.Thr275fs frameshift NM_001407637.1:c.812_821dup NP_001394566.1:p.Thr275fs frameshift NM_001407638.1:c.812_821dup NP_001394567.1:p.Thr275fs frameshift NM_001407639.1:c.815_824dup NP_001394568.1:p.Thr276fs frameshift NM_001407640.1:c.815_824dup NP_001394569.1:p.Thr276fs frameshift NM_001407641.1:c.815_824dup NP_001394570.1:p.Thr276fs frameshift NM_001407642.1:c.815_824dup NP_001394571.1:p.Thr276fs frameshift NM_001407644.1:c.812_821dup NP_001394573.1:p.Thr275fs frameshift NM_001407645.1:c.812_821dup NP_001394574.1:p.Thr275fs frameshift NM_001407646.1:c.806_815dup NP_001394575.1:p.Thr273fs frameshift NM_001407647.1:c.806_815dup NP_001394576.1:p.Thr273fs frameshift NM_001407648.1:c.692_701dup NP_001394577.1:p.Thr235fs frameshift NM_001407649.1:c.689_698dup NP_001394578.1:p.Thr234fs frameshift NM_001407652.1:c.815_824dup NP_001394581.1:p.Thr276fs frameshift NM_001407653.1:c.737_746dup NP_001394582.1:p.Thr250fs frameshift NM_001407654.1:c.737_746dup NP_001394583.1:p.Thr250fs frameshift NM_001407655.1:c.737_746dup NP_001394584.1:p.Thr250fs frameshift NM_001407656.1:c.737_746dup NP_001394585.1:p.Thr250fs frameshift NM_001407657.1:c.737_746dup NP_001394586.1:p.Thr250fs frameshift NM_001407658.1:c.737_746dup NP_001394587.1:p.Thr250fs frameshift NM_001407659.1:c.734_743dup NP_001394588.1:p.Thr249fs frameshift NM_001407660.1:c.734_743dup NP_001394589.1:p.Thr249fs frameshift NM_001407661.1:c.734_743dup NP_001394590.1:p.Thr249fs frameshift NM_001407662.1:c.734_743dup NP_001394591.1:p.Thr249fs frameshift NM_001407663.1:c.737_746dup NP_001394592.1:p.Thr250fs frameshift NM_001407664.1:c.692_701dup NP_001394593.1:p.Thr235fs frameshift NM_001407665.1:c.692_701dup NP_001394594.1:p.Thr235fs frameshift NM_001407666.1:c.692_701dup NP_001394595.1:p.Thr235fs frameshift NM_001407667.1:c.692_701dup NP_001394596.1:p.Thr235fs frameshift NM_001407668.1:c.692_701dup NP_001394597.1:p.Thr235fs frameshift NM_001407669.1:c.692_701dup NP_001394598.1:p.Thr235fs frameshift NM_001407670.1:c.689_698dup NP_001394599.1:p.Thr234fs frameshift NM_001407671.1:c.689_698dup NP_001394600.1:p.Thr234fs frameshift NM_001407672.1:c.689_698dup NP_001394601.1:p.Thr234fs frameshift NM_001407673.1:c.689_698dup NP_001394602.1:p.Thr234fs frameshift NM_001407674.1:c.692_701dup NP_001394603.1:p.Thr235fs frameshift NM_001407675.1:c.692_701dup NP_001394604.1:p.Thr235fs frameshift NM_001407676.1:c.692_701dup NP_001394605.1:p.Thr235fs frameshift NM_001407677.1:c.692_701dup NP_001394606.1:p.Thr235fs frameshift NM_001407678.1:c.692_701dup NP_001394607.1:p.Thr235fs frameshift NM_001407679.1:c.692_701dup NP_001394608.1:p.Thr235fs frameshift NM_001407680.1:c.692_701dup NP_001394609.1:p.Thr235fs frameshift NM_001407681.1:c.692_701dup NP_001394610.1:p.Thr235fs frameshift NM_001407682.1:c.692_701dup NP_001394611.1:p.Thr235fs frameshift NM_001407683.1:c.692_701dup NP_001394612.1:p.Thr235fs frameshift NM_001407684.1:c.815_824dup NP_001394613.1:p.Thr276fs frameshift NM_001407685.1:c.689_698dup NP_001394614.1:p.Thr234fs frameshift NM_001407686.1:c.689_698dup NP_001394615.1:p.Thr234fs frameshift NM_001407687.1:c.689_698dup NP_001394616.1:p.Thr234fs frameshift NM_001407688.1:c.689_698dup NP_001394617.1:p.Thr234fs frameshift NM_001407689.1:c.689_698dup NP_001394618.1:p.Thr234fs frameshift NM_001407690.1:c.689_698dup NP_001394619.1:p.Thr234fs frameshift NM_001407691.1:c.689_698dup NP_001394620.1:p.Thr234fs frameshift NM_001407692.1:c.674_683dup NP_001394621.1:p.Thr229fs frameshift NM_001407694.1:c.674_683dup NP_001394623.1:p.Thr229fs frameshift NM_001407695.1:c.674_683dup NP_001394624.1:p.Thr229fs frameshift NM_001407696.1:c.674_683dup NP_001394625.1:p.Thr229fs frameshift NM_001407697.1:c.674_683dup NP_001394626.1:p.Thr229fs frameshift NM_001407698.1:c.674_683dup NP_001394627.1:p.Thr229fs frameshift NM_001407724.1:c.674_683dup NP_001394653.1:p.Thr229fs frameshift NM_001407725.1:c.674_683dup NP_001394654.1:p.Thr229fs frameshift NM_001407726.1:c.674_683dup NP_001394655.1:p.Thr229fs frameshift NM_001407727.1:c.674_683dup NP_001394656.1:p.Thr229fs frameshift NM_001407728.1:c.674_683dup NP_001394657.1:p.Thr229fs frameshift NM_001407729.1:c.674_683dup NP_001394658.1:p.Thr229fs frameshift NM_001407730.1:c.674_683dup NP_001394659.1:p.Thr229fs frameshift NM_001407731.1:c.674_683dup NP_001394660.1:p.Thr229fs frameshift NM_001407732.1:c.674_683dup NP_001394661.1:p.Thr229fs frameshift NM_001407733.1:c.674_683dup NP_001394662.1:p.Thr229fs frameshift NM_001407734.1:c.674_683dup NP_001394663.1:p.Thr229fs frameshift NM_001407735.1:c.674_683dup NP_001394664.1:p.Thr229fs frameshift NM_001407736.1:c.674_683dup NP_001394665.1:p.Thr229fs frameshift NM_001407737.1:c.674_683dup NP_001394666.1:p.Thr229fs frameshift NM_001407738.1:c.674_683dup NP_001394667.1:p.Thr229fs frameshift NM_001407739.1:c.674_683dup NP_001394668.1:p.Thr229fs frameshift NM_001407740.1:c.671_680dup NP_001394669.1:p.Thr228fs frameshift NM_001407741.1:c.671_680dup NP_001394670.1:p.Thr228fs frameshift NM_001407742.1:c.671_680dup NP_001394671.1:p.Thr228fs frameshift NM_001407743.1:c.671_680dup NP_001394672.1:p.Thr228fs frameshift NM_001407744.1:c.671_680dup NP_001394673.1:p.Thr228fs frameshift NM_001407745.1:c.671_680dup NP_001394674.1:p.Thr228fs frameshift NM_001407746.1:c.671_680dup NP_001394675.1:p.Thr228fs frameshift NM_001407747.1:c.671_680dup NP_001394676.1:p.Thr228fs frameshift NM_001407748.1:c.671_680dup NP_001394677.1:p.Thr228fs frameshift NM_001407749.1:c.671_680dup NP_001394678.1:p.Thr228fs frameshift NM_001407750.1:c.674_683dup NP_001394679.1:p.Thr229fs frameshift NM_001407751.1:c.674_683dup NP_001394680.1:p.Thr229fs frameshift NM_001407752.1:c.674_683dup NP_001394681.1:p.Thr229fs frameshift NM_001407838.1:c.671_680dup NP_001394767.1:p.Thr228fs frameshift NM_001407839.1:c.671_680dup NP_001394768.1:p.Thr228fs frameshift NM_001407841.1:c.671_680dup NP_001394770.1:p.Thr228fs frameshift NM_001407842.1:c.671_680dup NP_001394771.1:p.Thr228fs frameshift NM_001407843.1:c.671_680dup NP_001394772.1:p.Thr228fs frameshift NM_001407844.1:c.671_680dup NP_001394773.1:p.Thr228fs frameshift NM_001407845.1:c.671_680dup NP_001394774.1:p.Thr228fs frameshift NM_001407846.1:c.671_680dup NP_001394775.1:p.Thr228fs frameshift NM_001407847.1:c.671_680dup NP_001394776.1:p.Thr228fs frameshift NM_001407848.1:c.671_680dup NP_001394777.1:p.Thr228fs frameshift NM_001407849.1:c.671_680dup NP_001394778.1:p.Thr228fs frameshift NM_001407850.1:c.674_683dup NP_001394779.1:p.Thr229fs frameshift NM_001407851.1:c.674_683dup NP_001394780.1:p.Thr229fs frameshift NM_001407852.1:c.674_683dup NP_001394781.1:p.Thr229fs frameshift NM_001407853.1:c.602_611dup NP_001394782.1:p.Thr205fs frameshift NM_001407854.1:c.815_824dup NP_001394783.1:p.Thr276fs frameshift NM_001407858.1:c.815_824dup NP_001394787.1:p.Thr276fs frameshift NM_001407859.1:c.815_824dup NP_001394788.1:p.Thr276fs frameshift NM_001407860.1:c.812_821dup NP_001394789.1:p.Thr275fs frameshift NM_001407861.1:c.812_821dup NP_001394790.1:p.Thr275fs frameshift NM_001407862.1:c.614_623dup NP_001394791.1:p.Thr209fs frameshift NM_001407863.1:c.692_701dup NP_001394792.1:p.Thr235fs frameshift NM_001407874.1:c.611_620dup NP_001394803.1:p.Thr208fs frameshift NM_001407875.1:c.611_620dup NP_001394804.1:p.Thr208fs frameshift NM_001407879.1:c.605_614dup NP_001394808.1:p.Thr206fs frameshift NM_001407881.1:c.605_614dup NP_001394810.1:p.Thr206fs frameshift NM_001407882.1:c.605_614dup NP_001394811.1:p.Thr206fs frameshift NM_001407884.1:c.605_614dup NP_001394813.1:p.Thr206fs frameshift NM_001407885.1:c.605_614dup NP_001394814.1:p.Thr206fs frameshift NM_001407886.1:c.605_614dup NP_001394815.1:p.Thr206fs frameshift NM_001407887.1:c.605_614dup NP_001394816.1:p.Thr206fs frameshift NM_001407889.1:c.605_614dup NP_001394818.1:p.Thr206fs frameshift NM_001407894.1:c.602_611dup NP_001394823.1:p.Thr205fs frameshift NM_001407895.1:c.602_611dup NP_001394824.1:p.Thr205fs frameshift NM_001407896.1:c.602_611dup NP_001394825.1:p.Thr205fs frameshift NM_001407897.1:c.602_611dup NP_001394826.1:p.Thr205fs frameshift NM_001407898.1:c.602_611dup NP_001394827.1:p.Thr205fs frameshift NM_001407899.1:c.602_611dup NP_001394828.1:p.Thr205fs frameshift NM_001407900.1:c.605_614dup NP_001394829.1:p.Thr206fs frameshift NM_001407902.1:c.605_614dup NP_001394831.1:p.Thr206fs frameshift NM_001407904.1:c.605_614dup NP_001394833.1:p.Thr206fs frameshift NM_001407906.1:c.605_614dup NP_001394835.1:p.Thr206fs frameshift NM_001407907.1:c.605_614dup NP_001394836.1:p.Thr206fs frameshift NM_001407908.1:c.605_614dup NP_001394837.1:p.Thr206fs frameshift NM_001407909.1:c.605_614dup NP_001394838.1:p.Thr206fs frameshift NM_001407910.1:c.605_614dup NP_001394839.1:p.Thr206fs frameshift NM_001407915.1:c.602_611dup NP_001394844.1:p.Thr205fs frameshift NM_001407916.1:c.602_611dup NP_001394845.1:p.Thr205fs frameshift NM_001407917.1:c.602_611dup NP_001394846.1:p.Thr205fs frameshift NM_001407918.1:c.602_611dup NP_001394847.1:p.Thr205fs frameshift NM_001407919.1:c.692_701dup NP_001394848.1:p.Thr235fs frameshift NM_001407920.1:c.551_560dup NP_001394849.1:p.Thr188fs frameshift NM_001407921.1:c.551_560dup NP_001394850.1:p.Thr188fs frameshift NM_001407922.1:c.551_560dup NP_001394851.1:p.Thr188fs frameshift NM_001407923.1:c.551_560dup NP_001394852.1:p.Thr188fs frameshift NM_001407924.1:c.551_560dup NP_001394853.1:p.Thr188fs frameshift NM_001407925.1:c.551_560dup NP_001394854.1:p.Thr188fs frameshift NM_001407926.1:c.551_560dup NP_001394855.1:p.Thr188fs frameshift NM_001407927.1:c.551_560dup NP_001394856.1:p.Thr188fs frameshift NM_001407928.1:c.551_560dup NP_001394857.1:p.Thr188fs frameshift NM_001407929.1:c.551_560dup NP_001394858.1:p.Thr188fs frameshift NM_001407930.1:c.548_557dup NP_001394859.1:p.Thr187fs frameshift NM_001407931.1:c.548_557dup NP_001394860.1:p.Thr187fs frameshift NM_001407932.1:c.548_557dup NP_001394861.1:p.Thr187fs frameshift NM_001407933.1:c.551_560dup NP_001394862.1:p.Thr188fs frameshift NM_001407934.1:c.548_557dup NP_001394863.1:p.Thr187fs frameshift NM_001407935.1:c.551_560dup NP_001394864.1:p.Thr188fs frameshift NM_001407936.1:c.548_557dup NP_001394865.1:p.Thr187fs frameshift NM_001407937.1:c.692_701dup NP_001394866.1:p.Thr235fs frameshift NM_001407938.1:c.692_701dup NP_001394867.1:p.Thr235fs frameshift NM_001407939.1:c.692_701dup NP_001394868.1:p.Thr235fs frameshift NM_001407940.1:c.689_698dup NP_001394869.1:p.Thr234fs frameshift NM_001407941.1:c.689_698dup NP_001394870.1:p.Thr234fs frameshift NM_001407942.1:c.674_683dup NP_001394871.1:p.Thr229fs frameshift NM_001407943.1:c.671_680dup NP_001394872.1:p.Thr228fs frameshift NM_001407944.1:c.674_683dup NP_001394873.1:p.Thr229fs frameshift NM_001407945.1:c.674_683dup NP_001394874.1:p.Thr229fs frameshift NM_001407946.1:c.482_491dup NP_001394875.1:p.Thr165fs frameshift NM_001407947.1:c.482_491dup NP_001394876.1:p.Thr165fs frameshift NM_001407948.1:c.482_491dup NP_001394877.1:p.Thr165fs frameshift NM_001407949.1:c.482_491dup NP_001394878.1:p.Thr165fs frameshift NM_001407950.1:c.482_491dup NP_001394879.1:p.Thr165fs frameshift NM_001407951.1:c.482_491dup NP_001394880.1:p.Thr165fs frameshift NM_001407952.1:c.482_491dup NP_001394881.1:p.Thr165fs frameshift NM_001407953.1:c.482_491dup NP_001394882.1:p.Thr165fs frameshift NM_001407954.1:c.479_488dup NP_001394883.1:p.Thr164fs frameshift NM_001407955.1:c.479_488dup NP_001394884.1:p.Thr164fs frameshift NM_001407956.1:c.479_488dup NP_001394885.1:p.Thr164fs frameshift NM_001407957.1:c.482_491dup NP_001394886.1:p.Thr165fs frameshift NM_001407958.1:c.479_488dup NP_001394887.1:p.Thr164fs frameshift NM_001407959.1:c.434_443dup NP_001394888.1:p.Thr149fs frameshift NM_001407960.1:c.434_443dup NP_001394889.1:p.Thr149fs frameshift NM_001407962.1:c.431_440dup NP_001394891.1:p.Thr148fs frameshift NM_001407963.1:c.434_443dup NP_001394892.1:p.Thr149fs frameshift NM_001407964.1:c.671_680dup NP_001394893.1:p.Thr228fs frameshift NM_001407965.1:c.311_320dup NP_001394894.1:p.Thr108fs frameshift NM_001407966.1:c.-74_-65dup 5 prime UTR NM_001407967.1:c.-74_-65dup 5 prime UTR NM_001407968.1:c.787+28_787+37dup intron variant NM_001407969.1:c.787+28_787+37dup intron variant NM_001407970.1:c.787+28_787+37dup intron variant NM_001407971.1:c.787+28_787+37dup intron variant NM_001407972.1:c.784+28_784+37dup intron variant NM_001407973.1:c.787+28_787+37dup intron variant NM_001407974.1:c.787+28_787+37dup intron variant NM_001407975.1:c.787+28_787+37dup intron variant NM_001407976.1:c.787+28_787+37dup intron variant NM_001407977.1:c.787+28_787+37dup intron variant NM_001407978.1:c.787+28_787+37dup intron variant NM_001407979.1:c.787+28_787+37dup intron variant NM_001407980.1:c.787+28_787+37dup intron variant NM_001407981.1:c.787+28_787+37dup intron variant NM_001407982.1:c.787+28_787+37dup intron variant NM_001407983.1:c.787+28_787+37dup intron variant NM_001407984.1:c.784+28_784+37dup intron variant NM_001407985.1:c.784+28_784+37dup intron variant NM_001407986.1:c.784+28_784+37dup intron variant NM_001407990.1:c.787+28_787+37dup intron variant NM_001407991.1:c.784+28_784+37dup intron variant NM_001407992.1:c.784+28_784+37dup intron variant NM_001407993.1:c.787+28_787+37dup intron variant NM_001408392.1:c.784+28_784+37dup intron variant NM_001408396.1:c.784+28_784+37dup intron variant NM_001408397.1:c.784+28_784+37dup intron variant NM_001408398.1:c.784+28_784+37dup intron variant NM_001408399.1:c.784+28_784+37dup intron variant NM_001408400.1:c.784+28_784+37dup intron variant NM_001408401.1:c.784+28_784+37dup intron variant NM_001408402.1:c.784+28_784+37dup intron variant NM_001408403.1:c.787+28_787+37dup intron variant NM_001408404.1:c.787+28_787+37dup intron variant NM_001408406.1:c.790+25_790+34dup intron variant NM_001408407.1:c.784+28_784+37dup intron variant NM_001408408.1:c.778+28_778+37dup intron variant NM_001408409.1:c.709+28_709+37dup intron variant NM_001408410.1:c.646+28_646+37dup intron variant NM_001408411.1:c.709+28_709+37dup intron variant NM_001408412.1:c.709+28_709+37dup intron variant NM_001408413.1:c.706+28_706+37dup intron variant NM_001408414.1:c.709+28_709+37dup intron variant NM_001408415.1:c.709+28_709+37dup intron variant NM_001408416.1:c.706+28_706+37dup intron variant NM_001408418.1:c.670+1130_670+1139dup intron variant NM_001408419.1:c.670+1130_670+1139dup intron variant NM_001408420.1:c.670+1130_670+1139dup intron variant NM_001408421.1:c.667+1130_667+1139dup intron variant NM_001408422.1:c.670+1130_670+1139dup intron variant NM_001408423.1:c.670+1130_670+1139dup intron variant NM_001408424.1:c.667+1130_667+1139dup intron variant NM_001408425.1:c.664+28_664+37dup intron variant NM_001408426.1:c.664+28_664+37dup intron variant NM_001408427.1:c.664+28_664+37dup intron variant NM_001408428.1:c.664+28_664+37dup intron variant NM_001408429.1:c.664+28_664+37dup intron variant NM_001408430.1:c.664+28_664+37dup intron variant NM_001408431.1:c.667+1130_667+1139dup intron variant NM_001408432.1:c.661+28_661+37dup intron variant NM_001408433.1:c.661+28_661+37dup intron variant NM_001408434.1:c.661+28_661+37dup intron variant NM_001408435.1:c.661+28_661+37dup intron variant NM_001408436.1:c.664+28_664+37dup intron variant NM_001408437.1:c.664+28_664+37dup intron variant NM_001408438.1:c.664+28_664+37dup intron variant NM_001408439.1:c.664+28_664+37dup intron variant NM_001408440.1:c.664+28_664+37dup intron variant NM_001408441.1:c.664+28_664+37dup intron variant NM_001408442.1:c.664+28_664+37dup intron variant NM_001408443.1:c.664+28_664+37dup intron variant NM_001408444.1:c.664+28_664+37dup intron variant NM_001408445.1:c.661+28_661+37dup intron variant NM_001408446.1:c.661+28_661+37dup intron variant NM_001408447.1:c.661+28_661+37dup intron variant NM_001408448.1:c.661+28_661+37dup intron variant NM_001408450.1:c.661+28_661+37dup intron variant NM_001408451.1:c.652+28_652+37dup intron variant NM_001408452.1:c.646+28_646+37dup intron variant NM_001408453.1:c.646+28_646+37dup intron variant NM_001408454.1:c.646+28_646+37dup intron variant NM_001408455.1:c.646+28_646+37dup intron variant NM_001408456.1:c.646+28_646+37dup intron variant NM_001408457.1:c.646+28_646+37dup intron variant NM_001408458.1:c.646+28_646+37dup intron variant NM_001408459.1:c.646+28_646+37dup intron variant NM_001408460.1:c.646+28_646+37dup intron variant NM_001408461.1:c.646+28_646+37dup intron variant NM_001408462.1:c.643+28_643+37dup intron variant NM_001408463.1:c.643+28_643+37dup intron variant NM_001408464.1:c.643+28_643+37dup intron variant NM_001408465.1:c.643+28_643+37dup intron variant NM_001408466.1:c.646+28_646+37dup intron variant NM_001408467.1:c.646+28_646+37dup intron variant NM_001408468.1:c.643+28_643+37dup intron variant NM_001408469.1:c.646+28_646+37dup intron variant NM_001408470.1:c.643+28_643+37dup intron variant NM_001408472.1:c.787+28_787+37dup intron variant NM_001408473.1:c.784+28_784+37dup intron variant NM_001408474.1:c.586+28_586+37dup intron variant NM_001408475.1:c.583+28_583+37dup intron variant NM_001408476.1:c.586+28_586+37dup intron variant NM_001408478.1:c.577+28_577+37dup intron variant NM_001408479.1:c.577+28_577+37dup intron variant NM_001408480.1:c.577+28_577+37dup intron variant NM_001408481.1:c.577+28_577+37dup intron variant NM_001408482.1:c.577+28_577+37dup intron variant NM_001408483.1:c.577+28_577+37dup intron variant NM_001408484.1:c.577+28_577+37dup intron variant NM_001408485.1:c.577+28_577+37dup intron variant NM_001408489.1:c.577+28_577+37dup intron variant NM_001408490.1:c.574+28_574+37dup intron variant NM_001408491.1:c.574+28_574+37dup intron variant NM_001408492.1:c.577+28_577+37dup intron variant NM_001408493.1:c.574+28_574+37dup intron variant NM_001408494.1:c.548-3684_548-3675dup intron variant NM_001408495.1:c.545-3684_545-3675dup intron variant NM_001408496.1:c.523+28_523+37dup intron variant NM_001408497.1:c.523+28_523+37dup intron variant NM_001408498.1:c.523+28_523+37dup intron variant NM_001408499.1:c.523+28_523+37dup intron variant NM_001408500.1:c.523+28_523+37dup intron variant NM_001408501.1:c.523+28_523+37dup intron variant NM_001408502.1:c.454+28_454+37dup intron variant NM_001408503.1:c.520+28_520+37dup intron variant NM_001408504.1:c.520+28_520+37dup intron variant NM_001408505.1:c.520+28_520+37dup intron variant NM_001408506.1:c.460+1130_460+1139dup intron variant NM_001408507.1:c.460+1130_460+1139dup intron variant NM_001408508.1:c.451+28_451+37dup intron variant NM_001408509.1:c.451+28_451+37dup intron variant NM_001408510.1:c.406+28_406+37dup intron variant NM_001408511.1:c.404-3684_404-3675dup intron variant NM_001408512.1:c.283+28_283+37dup intron variant NM_001408513.1:c.577+28_577+37dup intron variant NM_001408514.1:c.577+28_577+37dup intron variant NM_007294.3:c.815_824dupAGCCATGTGG frameshift NM_007297.4:c.674_683dup NP_009228.2:p.Thr229fs frameshift NM_007298.4:c.787+28_787+37dup intron variant NM_007299.4:c.787+28_787+37dup intron variant NM_007300.4:c.815_824dup NP_009231.2:p.Thr276fs frameshift NR_027676.1:n.944_953dup NC_000017.11:g.43094714_43094723dup NC_000017.10:g.41246731_41246740dup NG_005905.2:g.123268_123277dup LRG_292:g.123268_123277dup LRG_292t1:c.808_817dup LRG_292p1:p.Thr276Alafs - Protein change
- T229fs, T276fs, T164fs, T165fs, T205fs, T206fs, T234fs, T250fs, T188fs, T209fs, T148fs, T149fs, T208fs, T249fs, T108fs, T187fs, T228fs, T235fs, T273fs, T275fs
- Other names
-
943ins10-ter275
- Canonical SPDI
- NC_000017.11:43094706:CCACATGGCTCCACATG:CCACATGGCTCCACATGGCTCCACATG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| BRCA1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
13050 | 14856 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (10) |
reviewed by expert panel
|
Oct 18, 2016 | RCV000019258.22 | |
| Pathogenic (4) |
criteria provided, multiple submitters, no conflicts
|
Jan 27, 2024 | RCV000049156.28 | |
| Pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
Sep 1, 2023 | RCV000074602.37 | |
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Oct 1, 2023 | RCV000129599.20 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Feb 23, 2017 | RCV000468976.9 | |
| Pathogenic (1) |
no assertion criteria provided
|
Dec 18, 2014 | RCV000735513.9 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Dec 1, 2021 | RCV002496721.8 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Oct 18, 2016)
|
reviewed by expert panel
Method: curation
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
germline
|
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Accession: SCV000323916.2
First in ClinVar: Feb 26, 2016 Last updated: Feb 07, 2023 |
Comment:
Variant allele predicted to encode a truncated non-functional protein.
|
|
|
Pathogenic
(Feb 23, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Baylor Genetics
Accession: SCV000540938.1
First in ClinVar: Apr 17, 2017 Last updated: Apr 17, 2017 |
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Jan 01, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: yes
Allele origin:
germline
|
Genologica Medica
Additional submitter:
Servicio Andaluz de Salud, Hospital Universitario Virgen de la Victoria
Accession: SCV000577918.1
First in ClinVar: Nov 05, 2016 Last updated: Nov 05, 2016 |
Family history: yes
Ethnicity/Population group: Causasians
Geographic origin: Spain
Tissue: Blood
Secondary finding: no
|
|
|
Pathogenic
(Jan 30, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000699312.1
First in ClinVar: Dec 26, 2017 Last updated: Dec 26, 2017 |
Comment:
Variant summary: The BRCA1 c.815_824dupAGCCATGTGG (p.Thr276Alafs) variant results in a premature termination codon, predicted to cause a truncated or absent BRCA1 protein due to nonsense … (more)
Variant summary: The BRCA1 c.815_824dupAGCCATGTGG (p.Thr276Alafs) variant results in a premature termination codon, predicted to cause a truncated or absent BRCA1 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g.c.843_846delCTCA/p.Ser282fs). One in silico tool predicts a damaging outcome for this variant. This variant is absent in 121190 control chromosomes. It has been reported in multiple affected individuals and multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic. Taken together, this variant is classified as pathogenic. (less)
|
|
|
Pathogenic
(Mar 29, 2021)
|
criteria provided, single submitter
Method: curation
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Sema4, Sema4
Accession: SCV002537923.1
First in ClinVar: Jun 24, 2022 Last updated: Jun 24, 2022
Comment:
The BRCA1 c.815_824dup (p.T276AfsX14) variant has been reported in several individuals with breast and/or ovarian cancer (PMID: 28944232, 32025337, 22006311, 10417303). This variant is a … (more)
The BRCA1 c.815_824dup (p.T276AfsX14) variant has been reported in several individuals with breast and/or ovarian cancer (PMID: 28944232, 32025337, 22006311, 10417303). This variant is a founder variant in the African population (PMID: 10417303). This variant causes a frameshift at amino acid 276 that results in premature termination 14 amino acids downstream. At this location, this is predicted to cause nonsense-mediated decay and result in an absent protein (loss of function). This variant was observed in 1/24966 chromosomes in the African/African American population according to the Genome Aggregation Database (http://gnomad.broadinstitute.org, PMID: 32461654). This variant has been reported in ClinVar (Variation ID: 55723). Based on the current evidence available, this variant is interpreted as pathogenic. (less)
|
|
|
|
Pathogenic
(Oct 02, 2015)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
germline
|
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge
Accession: SCV000326435.4
First in ClinVar: Nov 05, 2016 Last updated: Dec 11, 2022 |
|
|
|
Pathogenic
(Jan 13, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV002506134.2
First in ClinVar: May 07, 2022 Last updated: Dec 24, 2022 |
Comment:
The BRCA1 c.815_824dup; p.Thr276AlafsTer14 variant (rs387906563) is reported in multiple individuals affected with breast and ovarian cancer (Mefford 1999, Stoppa-Lyonnet 1997, Walsh 2011, Zayas-Villanueva 2019). … (more)
The BRCA1 c.815_824dup; p.Thr276AlafsTer14 variant (rs387906563) is reported in multiple individuals affected with breast and ovarian cancer (Mefford 1999, Stoppa-Lyonnet 1997, Walsh 2011, Zayas-Villanueva 2019). This variant is also reported in ClinVar (Variation ID: 55723), and is classified as pathogenic by the evidence-based network for the interpretation of germline mutant alleles (ENIGMA) expert panel (see link to ENIGMA consortium classification criteria). This variant is absent from the Genome Aggregation Database, indicating it is not a common polymorphism. This variant causes a frameshift by inserting 10 nucleotides, so it is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on available information, this variant is considered to be pathogenic. References: Link to ENIGMA classification criteria: https://enigmaconsortium.org/library/general-documents/enigma-classification-criteria/ Mefford HC et al. Evidence for a BRCA1 founder mutation in families of West African ancestry. Am J Hum Genet. 1999 Aug;65(2):575-8. PMID: 10417303. Stoppa-Lyonnet D et al. BRCA1 sequence variations in 160 individuals referred to a breast/ovarian family cancer clinic. Institut Curie Breast Cancer Group. Am J Hum Genet. 1997 May;60(5):1021-30. PMID: 9150149. Walsh T et al. Mutations in 12 genes for inherited ovarian, fallopian tube, and peritoneal carcinoma identified by massively parallel sequencing. Proc Natl Acad Sci U S A. 2011 Nov 1;108(44):18032-7. PMID: 22006311. Zayas-Villanueva OA et al. Analysis of the pathogenic variants of BRCA1 and BRCA2 using next-generation sequencing in women with familial breast cancer: a case-control study. BMC Cancer. 2019 Jul 22;19(1):722. PMID: 31331294. (less)
|
|
|
Pathogenic
(Mar 18, 2015)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000677715.2
First in ClinVar: Nov 05, 2016 Last updated: Dec 24, 2022 |
|
|
|
Pathogenic
(Oct 29, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000184383.7
First in ClinVar: Aug 06, 2014 Last updated: Mar 04, 2023 |
Comment:
The c.815_824dup10 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of AGCCATGTGG at nucleotide position 815, causing a … (more)
The c.815_824dup10 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of AGCCATGTGG at nucleotide position 815, causing a translational frameshift with a predicted alternate stop codon (p.T276Afs*14). This pathogenic mutation has been reported in numerous hereditary breast and ovarian cancer (HBOC) syndrome families, and it has been established as a founder mutation of African origin (Stoppa-Lyonnet D et al. Am. J. Hum. Genet. 1997 May;60:1021-30; Mefford HC et al. Am. J. Hum. Genet. 1999 Aug;65:575-8; Panguluri RC et al. Hum. Genet. 1999 Jul-Aug;105:28-31; Pal T et al. Cancer Epidemiol. Biomarkers Prev. 2004 Nov;13:1794-9; Ferla R et al. Ann. Oncol. 2007 Jun;18 Suppl 6:vi93-8; Zhang J et al. Breast Cancer Res. Treat. 2012 Jul;134:889-94; Jara L et al. Biol. Res. 2017 Oct;50:35). Of note, this alteration is also designated as 943ins10 in published literature. In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Dec 30, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000108688.10
First in ClinVar: Dec 10, 2013 Last updated: Mar 04, 2023 |
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Observed … (more)
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Observed in individuals with a personal or family history consistent with pathogenic variants in this gene and has been described as a pathogenic founder variant of African origin (Mefford 1999, Pal 2004, Stoppa-Lyonnet 1997, Walsh 2011, Villarreal-Garza 2015, Rummel 2017); Not observed at a significant frequency in large population cohorts (gnomAD); Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; Also known as 926ins10, 934_943dup10, or 943ins10; This variant is associated with the following publications: (PMID: 26071757, 32025337, 27742776, 22006311, 9150149, 15533909, 10417303, 25920394, 26681312, 25256238, 22739995, 28944232, 28503720, 30262796, 30720243, 30322717, 31331294, 25716084, 31447099, 32832836, 32341426, 33646313) (less)
|
|
|
Pathogenic
(Oct 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000683367.4
First in ClinVar: Feb 19, 2018 Last updated: Feb 14, 2024 |
Comment:
This variant inserts 10 nucleotides in exon 10 of the BRCA1 gene, creating a frameshift and premature translation stop signal. This variant is expected to … (more)
This variant inserts 10 nucleotides in exon 10 of the BRCA1 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in at least fifteen individuals and over two dozen families affected with breast and ovarian cancer (PMID: 9150149, 10417303, 15533909, 19241424, 20838878, 21120943, 22006311, 21913181, 22739995, 26681312, 28503720, 28944232, 30322717, 32025337, 32341426, 33646313, 34413315) and prostate cancer (PMID: 32832836). Haplotype analysis suggests that this variant may be founder mutation originating from West African (PMID: 10417303, 32025337). This variant has been identified in 2/282168 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. (less)
|
|
|
Pathogenic
(Dec 13, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: unknown
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV004847396.1
First in ClinVar: Apr 20, 2024 Last updated: Apr 20, 2024 |
Comment:
The p.Thr276AlafsX14 variant in BRCA1 has been reported in multiple individuals with BRCA1-associated cancers bnand is believed to be a founder variant of African origin … (more)
The p.Thr276AlafsX14 variant in BRCA1 has been reported in multiple individuals with BRCA1-associated cancers bnand is believed to be a founder variant of African origin (Stoppa-Lyonnet 1997 PMID: 9150149, Mefford 1999 PMID: 10417303, Walsh 2011 PMID: 22006311, Buleje 2017 PMID: 28944232). This variant has also been reported by other clinical laboratories in ClinVar (Variation ID 55723) and has been identified in 0.01% (4/41360) of African or African American chromosomes by gnomAD (http://gnomad.broadinstitute.org, v.3.1.2). This frequency is low enough to be consistent with the frequency of hereditary breast and ovarian cancer (HBOC) in the general population. This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 276 and leads to a premature termination codon 14 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Heterozygous loss of function of the BRCA1 gene is an established disease mechanism in autosomal dominant HBOC. In the compound heterozygous or homozygous state, these variants are associated with autosomal recessive Fanconi anemia. In summary, this variant meets criteria to be classified as pathogenic for autosomal dominant HBOC. ACMG/AMP Criteria applied: PVS1, PS4_Moderate, PM2_Supporting. (less)
|
|
|
Pathogenic
(Mar 20, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004212738.2
First in ClinVar: Dec 30, 2023 Last updated: Jun 17, 2024 |
|
|
|
Pathogenic
(Aug 21, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: unknown
Allele origin:
germline
|
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine
Accession: SCV000839904.1
First in ClinVar: Nov 05, 2016 Last updated: Nov 05, 2016 |
Comment:
The c.815_824 frameshift change in BRCA1 has been reported in multiple unrelated patients with breast, ovarian or prostate cancer [PMID 9150149, 10417303, 22006311, 15533909]. This … (more)
The c.815_824 frameshift change in BRCA1 has been reported in multiple unrelated patients with breast, ovarian or prostate cancer [PMID 9150149, 10417303, 22006311, 15533909]. This variant is classified as pathogenic. It is recommended that the zygosity (heterozygous vs. mosaic) of this change be confirmed by Sanger sequencing as NGS variant calling may lead to skewed allele fractions for an indel of this size. (less)
|
|
|
Pathogenic
(Oct 06, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: yes
Allele origin:
germline
|
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein
Accession: SCV002512517.1
First in ClinVar: May 21, 2022 Last updated: May 21, 2022 |
Comment:
ACMG classification criteria: PVS1 very strong, PS4 strong, PM2 moderate
Geographic origin: Brazil
|
|
|
Pathogenic
(Dec 01, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Breast-ovarian cancer, familial, susceptibility to, 1 Pancreatic cancer, susceptibility to, 4 Fanconi anemia, complementation group S
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002809679.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
|
Pathogenic
(May 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
unknown
|
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV000296290.7
First in ClinVar: Feb 26, 2016 Last updated: Jan 06, 2024 |
Comment:
This frameshift variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. The frequency of this … (more)
This frameshift variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. The frequency of this variant in the general population, 0.0000071 (2/282168 chromosomes, http://gnomad.broadinstitute.org), is consistent with pathogenicity. In the published literature, the variant has been reported in individuals with breast cancer (PMID: 33646313 (2021), 32341426 (2020), 31331294 (2019), 30262796 (2018)) and ovarian cancer (PMID: 30322717 (2018)). In addition, this variant has been reported as a founder mutation of African origin (PMID: 10417303 (1999), 21120943 (2011), 22762150 (2012)). Based on the available information, this variant is classified as pathogenic. (less)
|
|
|
Pathogenic
(Aug 05, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not provided
Affected status: unknown
Allele origin:
germline
|
Mayo Clinic Laboratories, Mayo Clinic
Accession: SCV004224916.1
First in ClinVar: Jan 06, 2024 Last updated: Jan 06, 2024 |
Comment:
PP5, PM2, PVS1
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Jan 27, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV000077169.16
First in ClinVar: Jul 03, 2013 Last updated: Feb 20, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Thr276Alafs*14) in the BRCA1 gene. It is expected to result in an absent or disrupted protein … (more)
This sequence change creates a premature translational stop signal (p.Thr276Alafs*14) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is present in population databases (rs387906563, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with breast and ovarian cancer (PMID: 9150149, 10417303, 26681312, 28503720). This variant is also known as 926ins10, ter289, and 943ins10. ClinVar contains an entry for this variant (Variation ID: 55723). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Sep 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV004041998.11
First in ClinVar: Oct 14, 2023 Last updated: Oct 20, 2024 |
Comment:
BRCA1: PVS1, PM2
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Aug 01, 1999)
|
no assertion criteria provided
Method: literature only
|
BREAST-OVARIAN CANCER, FAMILIAL, SUSCEPTIBILITY TO, 1
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000039546.1
First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013 |
Comment on evidence:
Mefford et al. (1999) suggested that a 10-bp insertion at nucleotide 943 of the BRCA1 gene represents a founder mutation of African origin in patients … (more)
Mefford et al. (1999) suggested that a 10-bp insertion at nucleotide 943 of the BRCA1 gene represents a founder mutation of African origin in patients with breast-ovarian cancer (604370). (less)
|
|
|
Pathogenic
(Mar 09, 2015)
|
no assertion criteria provided
Method: research
|
Breast-ovarian cancer, familial, susceptibility to, 1
(Autosomal dominant inheritance)
Affected status: not applicable
Allele origin:
not applicable
|
Centro de Genética y Biología Molecular, Universidad de San Martín de Porres
Study: Mutational analysis of BRCA1 and BRCA2 genes in peruvian families with hereditary breast and ovarian cancer
Accession: SCV000263346.1 First in ClinVar: Feb 26, 2016 Last updated: Feb 26, 2016 |
Sex: female
Tissue: Blood
Comment on evidence:
Pathogenic mutation
|
|
|
Pathogenic
(Dec 18, 2014)
|
no assertion criteria provided
Method: clinical testing
|
Breast and/or ovarian cancer
Affected status: unknown
Allele origin:
germline
|
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research
Study: The Canadian Open Genetics Repository (COGR)
Accession: SCV000863651.1 First in ClinVar: Dec 24, 2018 Last updated: Dec 24, 2018 |
|
|
|
Pathogenic
(Mar 02, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Breast-ovarian cancer, familial, susceptibility to, 1
Affected status: yes
Allele origin:
germline
|
BRCAlab, Lund University
Accession: SCV004244145.1
First in ClinVar: Feb 14, 2024 Last updated: Feb 14, 2024 |
|
|
|
not provided
(-)
|
no classification provided
Method: literature only
|
Hereditary breast ovarian cancer syndrome
Affected status: unknown
Allele origin:
germline
|
GeneReviews
Accession: SCV002097627.2
First in ClinVar: Feb 20, 2022 Last updated: Oct 01, 2022 |
Comment:
Founder variant in those of West African ancestry
|
|
| click to load more click to collapse | |||||
Comment:
Comment:
Variant summary: The BRCA1 c.815_824dupAGCCATGTGG (p.Thr276Alafs) variant results in a premature termination codon, predicted to cause a truncated or absent BRCA1 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g.c.843_846delCTCA/p.Ser282fs). One in silico tool predicts a damaging outcome for this variant. This variant is absent in 121190 control chromosomes. It has been reported in multiple affected individuals and multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic. Taken together, this variant is classified as pathogenic.
Comment:
The BRCA1 c.815_824dup; p.Thr276AlafsTer14 variant (rs387906563) is reported in multiple individuals affected with breast and ovarian cancer (Mefford 1999, Stoppa-Lyonnet 1997, Walsh 2011, Zayas-Villanueva 2019). This variant is also reported in ClinVar (Variation ID: 55723), and is classified as pathogenic by the evidence-based network for the interpretation of germline mutant alleles (ENIGMA) expert panel (see link to ENIGMA consortium classification criteria). This variant is absent from the Genome Aggregation Database, indicating it is not a common polymorphism. This variant causes a frameshift by inserting 10 nucleotides, so it is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on available information, this variant is considered to be pathogenic. References: Link to ENIGMA classification criteria: https://enigmaconsortium.org/library/general-documents/enigma-classification-criteria/ Mefford HC et al. Evidence for a BRCA1 founder mutation in families of West African ancestry. Am J Hum Genet. 1999 Aug;65(2):575-8. PMID: 10417303. Stoppa-Lyonnet D et al. BRCA1 sequence variations in 160 individuals referred to a breast/ovarian family cancer clinic. Institut Curie Breast Cancer Group. Am J Hum Genet. 1997 May;60(5):1021-30. PMID: 9150149. Walsh T et al. Mutations in 12 genes for inherited ovarian, fallopian tube, and peritoneal carcinoma identified by massively parallel sequencing. Proc Natl Acad Sci U S A. 2011 Nov 1;108(44):18032-7. PMID: 22006311. Zayas-Villanueva OA et al. Analysis of the pathogenic variants of BRCA1 and BRCA2 using next-generation sequencing in women with familial breast cancer: a case-control study. BMC Cancer. 2019 Jul 22;19(1):722. PMID: 31331294.
Comment:
The c.815_824dup10 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of AGCCATGTGG at nucleotide position 815, causing a translational frameshift with a predicted alternate stop codon (p.T276Afs*14). This pathogenic mutation has been reported in numerous hereditary breast and ovarian cancer (HBOC) syndrome families, and it has been established as a founder mutation of African origin (Stoppa-Lyonnet D et al. Am. J. Hum. Genet. 1997 May;60:1021-30; Mefford HC et al. Am. J. Hum. Genet. 1999 Aug;65:575-8; Panguluri RC et al. Hum. Genet. 1999 Jul-Aug;105:28-31; Pal T et al. Cancer Epidemiol. Biomarkers Prev. 2004 Nov;13:1794-9; Ferla R et al. Ann. Oncol. 2007 Jun;18 Suppl 6:vi93-8; Zhang J et al. Breast Cancer Res. Treat. 2012 Jul;134:889-94; Jara L et al. Biol. Res. 2017 Oct;50:35). Of note, this alteration is also designated as 943ins10 in published literature. In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Observed in individuals with a personal or family history consistent with pathogenic variants in this gene and has been described as a pathogenic founder variant of African origin (Mefford 1999, Pal 2004, Stoppa-Lyonnet 1997, Walsh 2011, Villarreal-Garza 2015, Rummel 2017); Not observed at a significant frequency in large population cohorts (gnomAD); Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; Also known as 926ins10, 934_943dup10, or 943ins10; This variant is associated with the following publications: (PMID: 26071757, 32025337, 27742776, 22006311, 9150149, 15533909, 10417303, 25920394, 26681312, 25256238, 22739995, 28944232, 28503720, 30262796, 30720243, 30322717, 31331294, 25716084, 31447099, 32832836, 32341426, 33646313)
Comment:
This variant inserts 10 nucleotides in exon 10 of the BRCA1 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in at least fifteen individuals and over two dozen families affected with breast and ovarian cancer (PMID: 9150149, 10417303, 15533909, 19241424, 20838878, 21120943, 22006311, 21913181, 22739995, 26681312, 28503720, 28944232, 30322717, 32025337, 32341426, 33646313, 34413315) and prostate cancer (PMID: 32832836). Haplotype analysis suggests that this variant may be founder mutation originating from West African (PMID: 10417303, 32025337). This variant has been identified in 2/282168 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic.
Comment:
The p.Thr276AlafsX14 variant in BRCA1 has been reported in multiple individuals with BRCA1-associated cancers bnand is believed to be a founder variant of African origin (Stoppa-Lyonnet 1997 PMID: 9150149, Mefford 1999 PMID: 10417303, Walsh 2011 PMID: 22006311, Buleje 2017 PMID: 28944232). This variant has also been reported by other clinical laboratories in ClinVar (Variation ID 55723) and has been identified in 0.01% (4/41360) of African or African American chromosomes by gnomAD (http://gnomad.broadinstitute.org, v.3.1.2). This frequency is low enough to be consistent with the frequency of hereditary breast and ovarian cancer (HBOC) in the general population. This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 276 and leads to a premature termination codon 14 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Heterozygous loss of function of the BRCA1 gene is an established disease mechanism in autosomal dominant HBOC. In the compound heterozygous or homozygous state, these variants are associated with autosomal recessive Fanconi anemia. In summary, this variant meets criteria to be classified as pathogenic for autosomal dominant HBOC. ACMG/AMP Criteria applied: PVS1, PS4_Moderate, PM2_Supporting.
Comment:
The c.815_824 frameshift change in BRCA1 has been reported in multiple unrelated patients with breast, ovarian or prostate cancer [PMID 9150149, 10417303, 22006311, 15533909]. This variant is classified as pathogenic. It is recommended that the zygosity (heterozygous vs. mosaic) of this change be confirmed by Sanger sequencing as NGS variant calling may lead to skewed allele fractions for an indel of this size.
Comment:
ACMG classification criteria: PVS1 very strong, PS4 strong, PM2 moderate
Comment:
This frameshift variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. The frequency of this variant in the general population, 0.0000071 (2/282168 chromosomes, http://gnomad.broadinstitute.org), is consistent with pathogenicity. In the published literature, the variant has been reported in individuals with breast cancer (PMID: 33646313 (2021), 32341426 (2020), 31331294 (2019), 30262796 (2018)) and ovarian cancer (PMID: 30322717 (2018)). In addition, this variant has been reported as a founder mutation of African origin (PMID: 10417303 (1999), 21120943 (2011), 22762150 (2012)). Based on the available information, this variant is classified as pathogenic.
Comment:
PP5, PM2, PVS1
Comment:
This sequence change creates a premature translational stop signal (p.Thr276Alafs*14) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is present in population databases (rs387906563, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with breast and ovarian cancer (PMID: 9150149, 10417303, 26681312, 28503720). This variant is also known as 926ins10, ter289, and 943ins10. ClinVar contains an entry for this variant (Variation ID: 55723). For these reasons, this variant has been classified as Pathogenic.
Comment:
BRCA1: PVS1, PM2
Comment:
Founder variant in those of West African ancestry
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
Variant allele predicted to encode a truncated non-functional protein.
Comment:
Variant summary: The BRCA1 c.815_824dupAGCCATGTGG (p.Thr276Alafs) variant results in a premature termination codon, predicted to cause a truncated or absent BRCA1 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g.c.843_846delCTCA/p.Ser282fs). One in silico tool predicts a damaging outcome for this variant. This variant is absent in 121190 control chromosomes. It has been reported in multiple affected individuals and multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic. Taken together, this variant is classified as pathogenic.
Comment:
The BRCA1 c.815_824dup; p.Thr276AlafsTer14 variant (rs387906563) is reported in multiple individuals affected with breast and ovarian cancer (Mefford 1999, Stoppa-Lyonnet 1997, Walsh 2011, Zayas-Villanueva 2019). This variant is also reported in ClinVar (Variation ID: 55723), and is classified as pathogenic by the evidence-based network for the interpretation of germline mutant alleles (ENIGMA) expert panel (see link to ENIGMA consortium classification criteria). This variant is absent from the Genome Aggregation Database, indicating it is not a common polymorphism. This variant causes a frameshift by inserting 10 nucleotides, so it is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on available information, this variant is considered to be pathogenic. References: Link to ENIGMA classification criteria: https://enigmaconsortium.org/library/general-documents/enigma-classification-criteria/ Mefford HC et al. Evidence for a BRCA1 founder mutation in families of West African ancestry. Am J Hum Genet. 1999 Aug;65(2):575-8. PMID: 10417303. Stoppa-Lyonnet D et al. BRCA1 sequence variations in 160 individuals referred to a breast/ovarian family cancer clinic. Institut Curie Breast Cancer Group. Am J Hum Genet. 1997 May;60(5):1021-30. PMID: 9150149. Walsh T et al. Mutations in 12 genes for inherited ovarian, fallopian tube, and peritoneal carcinoma identified by massively parallel sequencing. Proc Natl Acad Sci U S A. 2011 Nov 1;108(44):18032-7. PMID: 22006311. Zayas-Villanueva OA et al. Analysis of the pathogenic variants of BRCA1 and BRCA2 using next-generation sequencing in women with familial breast cancer: a case-control study. BMC Cancer. 2019 Jul 22;19(1):722. PMID: 31331294.
Comment:
The c.815_824dup10 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a duplication of AGCCATGTGG at nucleotide position 815, causing a translational frameshift with a predicted alternate stop codon (p.T276Afs*14). This pathogenic mutation has been reported in numerous hereditary breast and ovarian cancer (HBOC) syndrome families, and it has been established as a founder mutation of African origin (Stoppa-Lyonnet D et al. Am. J. Hum. Genet. 1997 May;60:1021-30; Mefford HC et al. Am. J. Hum. Genet. 1999 Aug;65:575-8; Panguluri RC et al. Hum. Genet. 1999 Jul-Aug;105:28-31; Pal T et al. Cancer Epidemiol. Biomarkers Prev. 2004 Nov;13:1794-9; Ferla R et al. Ann. Oncol. 2007 Jun;18 Suppl 6:vi93-8; Zhang J et al. Breast Cancer Res. Treat. 2012 Jul;134:889-94; Jara L et al. Biol. Res. 2017 Oct;50:35). Of note, this alteration is also designated as 943ins10 in published literature. In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Observed in individuals with a personal or family history consistent with pathogenic variants in this gene and has been described as a pathogenic founder variant of African origin (Mefford 1999, Pal 2004, Stoppa-Lyonnet 1997, Walsh 2011, Villarreal-Garza 2015, Rummel 2017); Not observed at a significant frequency in large population cohorts (gnomAD); Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; Also known as 926ins10, 934_943dup10, or 943ins10; This variant is associated with the following publications: (PMID: 26071757, 32025337, 27742776, 22006311, 9150149, 15533909, 10417303, 25920394, 26681312, 25256238, 22739995, 28944232, 28503720, 30262796, 30720243, 30322717, 31331294, 25716084, 31447099, 32832836, 32341426, 33646313)
Comment:
This variant inserts 10 nucleotides in exon 10 of the BRCA1 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in at least fifteen individuals and over two dozen families affected with breast and ovarian cancer (PMID: 9150149, 10417303, 15533909, 19241424, 20838878, 21120943, 22006311, 21913181, 22739995, 26681312, 28503720, 28944232, 30322717, 32025337, 32341426, 33646313, 34413315) and prostate cancer (PMID: 32832836). Haplotype analysis suggests that this variant may be founder mutation originating from West African (PMID: 10417303, 32025337). This variant has been identified in 2/282168 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic.
Comment:
The p.Thr276AlafsX14 variant in BRCA1 has been reported in multiple individuals with BRCA1-associated cancers bnand is believed to be a founder variant of African origin (Stoppa-Lyonnet 1997 PMID: 9150149, Mefford 1999 PMID: 10417303, Walsh 2011 PMID: 22006311, Buleje 2017 PMID: 28944232). This variant has also been reported by other clinical laboratories in ClinVar (Variation ID 55723) and has been identified in 0.01% (4/41360) of African or African American chromosomes by gnomAD (http://gnomad.broadinstitute.org, v.3.1.2). This frequency is low enough to be consistent with the frequency of hereditary breast and ovarian cancer (HBOC) in the general population. This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 276 and leads to a premature termination codon 14 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Heterozygous loss of function of the BRCA1 gene is an established disease mechanism in autosomal dominant HBOC. In the compound heterozygous or homozygous state, these variants are associated with autosomal recessive Fanconi anemia. In summary, this variant meets criteria to be classified as pathogenic for autosomal dominant HBOC. ACMG/AMP Criteria applied: PVS1, PS4_Moderate, PM2_Supporting.
Comment:
The c.815_824 frameshift change in BRCA1 has been reported in multiple unrelated patients with breast, ovarian or prostate cancer [PMID 9150149, 10417303, 22006311, 15533909]. This variant is classified as pathogenic. It is recommended that the zygosity (heterozygous vs. mosaic) of this change be confirmed by Sanger sequencing as NGS variant calling may lead to skewed allele fractions for an indel of this size.
Comment:
ACMG classification criteria: PVS1 very strong, PS4 strong, PM2 moderate
Comment:
This frameshift variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. The frequency of this variant in the general population, 0.0000071 (2/282168 chromosomes, http://gnomad.broadinstitute.org), is consistent with pathogenicity. In the published literature, the variant has been reported in individuals with breast cancer (PMID: 33646313 (2021), 32341426 (2020), 31331294 (2019), 30262796 (2018)) and ovarian cancer (PMID: 30322717 (2018)). In addition, this variant has been reported as a founder mutation of African origin (PMID: 10417303 (1999), 21120943 (2011), 22762150 (2012)). Based on the available information, this variant is classified as pathogenic.
Comment:
PP5, PM2, PVS1
Comment:
This sequence change creates a premature translational stop signal (p.Thr276Alafs*14) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is present in population databases (rs387906563, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with breast and ovarian cancer (PMID: 9150149, 10417303, 26681312, 28503720). This variant is also known as 926ins10, ter289, and 943ins10. ClinVar contains an entry for this variant (Variation ID: 55723). For these reasons, this variant has been classified as Pathogenic.
Comment:
BRCA1: PVS1, PM2
Comment:
Founder variant in those of West African ancestry
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| BRCA1- and BRCA2-Associated Hereditary Breast and Ovarian Cancer. | Adam MP | - | 2023 | PMID: 20301425 |
| Screening of BRCA1/2 variants in Mauritanian breast cancer patients. | Brahim SM | BMC cancer | 2022 | PMID: 35858847 |
| Influence of germline BRCA genotype on the survival of patients with triple-negative breast cancer. | Villarreal-Garza C | Cancer research communications | 2021 | PMID: 35875314 |
| Genetic epidemiology of BRCA1- and BRCA2-associated cancer across Latin America. | Herzog JS | NPJ breast cancer | 2021 | PMID: 34413315 |
| Gene Sequencing for Pathogenic Variants Among Adults With Breast and Ovarian Cancer in the Caribbean. | George SHL | JAMA network open | 2021 | PMID: 33646313 |
| Pathogenic Variants in Cancer Predisposition Genes and Prostate Cancer Risk in Men of African Ancestry. | Matejcic M | JCO precision oncology | 2020 | PMID: 32832836 |
| Spectrum of Germline BRCA1 and BRCA2 Variants Identified in 2351 Ovarian and Breast Cancer Patients Referring to a Reference Cancer Hospital of Rome. | Santonocito C | Cancers | 2020 | PMID: 32438681 |
| Clinical outcome of breast cancer in carriers of BRCA1 and BRCA2 mutations according to molecular subtypes. | De Talhouet S | Scientific reports | 2020 | PMID: 32341426 |
| Evidence for an ancient BRCA1 pathogenic variant in inherited breast cancer patients from Senegal. | Ndiaye R | NPJ genomic medicine | 2020 | PMID: 32025337 |
| Harmonizing Clinical Sequencing and Interpretation for the eMERGE III Network. | eMERGE Consortium. Electronic address: [email protected] | American journal of human genetics | 2019 | PMID: 31447099 |
| Analysis of the pathogenic variants of BRCA1 and BRCA2 using next-generation sequencing in women with familial breast cancer: a case-control study. | Zayas-Villanueva OA | BMC cancer | 2019 | PMID: 31331294 |
| High prevalence of cancer-associated TP53 variants in the gnomAD database: A word of caution concerning the use of variant filtering. | Soussi T | Human mutation | 2019 | PMID: 30720243 |
| Germline pathogenic variants identified in women with ovarian tumors. | Carter NJ | Gynecologic oncology | 2018 | PMID: 30322717 |
| Comprehensive Analysis of Germline Variants in Mexican Patients with Hereditary Breast and Ovarian Cancer Susceptibility. | Quezada Urban R | Cancers | 2018 | PMID: 30262796 |
| Real-time Genomic Characterization of Advanced Pancreatic Cancer to Enable Precision Medicine. | Aguirre AJ | Cancer discovery | 2018 | PMID: 29903880 |
| Mutational analysis of BRCA1 and BRCA2 genes in Peruvian families with hereditary breast and ovarian cancer. | Buleje J | Molecular genetics & genomic medicine | 2017 | PMID: 28944232 |
| Contribution of germline mutations in cancer predisposition genes to tumor etiology in young women diagnosed with invasive breast cancer. | Rummel SK | Breast cancer research and treatment | 2017 | PMID: 28503720 |
| Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas. | Weren RD | Human mutation | 2017 | PMID: 27767231 |
| Pathogenic and likely pathogenic variant prevalence among the first 10,000 patients referred for next-generation cancer panel testing. | Susswein LR | Genetics in medicine : official journal of the American College of Medical Genetics | 2016 | PMID: 26681312 |
| Variation in breast cancer risk associated with factors related to pregnancies according to truncating mutation location, in the French National BRCA1 and BRCA2 mutations carrier cohort (GENEPSO). | Lecarpentier J | Breast cancer research : BCR | 2012 | PMID: 22762150 |
| Recurrent BRCA1 and BRCA2 mutations in breast cancer patients of African ancestry. | Zhang J | Breast cancer research and treatment | 2012 | PMID: 22739995 |
| Earlier age of onset of BRCA mutation-related cancers in subsequent generations. | Litton JK | Cancer | 2012 | PMID: 21913181 |
| Novel BRCA1 deleterious mutation (c.1949_1950delTA) in a woman of Senegalese descent with triple-negative early-onset breast cancer. | Diez O | Oncology letters | 2011 | PMID: 22848303 |
| Mutations in 12 genes for inherited ovarian, fallopian tube, and peritoneal carcinoma identified by massively parallel sequencing. | Walsh T | Proceedings of the National Academy of Sciences of the United States of America | 2011 | PMID: 22006311 |
| EMMA, a cost- and time-effective diagnostic method for simultaneous detection of point mutations and large-scale genomic rearrangements: application to BRCA1 and BRCA2 in 1,525 patients. | Caux-Moncoutier V | Human mutation | 2011 | PMID: 21120943 |
| A high prevalence of BRCA1 mutations among breast cancer patients from the Bahamas. | Donenberg T | Breast cancer research and treatment | 2011 | PMID: 20838878 |
| Characterization of BRCA1 and BRCA2 deleterious mutations and variants of unknown clinical significance in unilateral and bilateral breast cancer: the WECARE study. | Borg A | Human mutation | 2010 | PMID: 20104584 |
| BRCA1 and BRCA2 mutations in women of different ethnicities undergoing testing for hereditary breast-ovarian cancer. | Hall MJ | Cancer | 2009 | PMID: 19241424 |
| Founder mutations in BRCA1 and BRCA2 genes. | Ferla R | Annals of oncology : official journal of the European Society for Medical Oncology | 2007 | PMID: 17591843 |
| BRCA1 and BRCA2 mutations in a study of African American breast cancer patients. | Pal T | Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology | 2004 | PMID: 15533909 |
| Breast cancer genetics in African Americans. | Olopade OI | Cancer | 2003 | PMID: 12491487 |
| Founder populations and their uses for breast cancer genetics. | Neuhausen SL | Breast cancer research : BCR | 2000 | PMID: 11250694 |
| BRCA1 mutations in African Americans. | Panguluri RC | Human genetics | 1999 | PMID: 10480351 |
| Evidence for a BRCA1 founder mutation in families of West African ancestry. | Mefford HC | American journal of human genetics | 1999 | PMID: 10417303 |
| BRCA1 sequence variations in 160 individuals referred to a breast/ovarian family cancer clinic. Institut Curie Breast Cancer Group. | Stoppa-Lyonnet D | American journal of human genetics | 1997 | PMID: 9150149 |
| click to load more click to collapse | ||||
Text-mined citations for rs387906563 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Nov 25, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.