Variant summary: RMRP n.-22_-3dup20 involves the duplication of 20 nucleotides in the promoter region of RMRP, which is located between the TATA box (-33 to -25) and the transcription initiation site. Other insertions or duplications in the promoter region of RMRP have been classified as pathogenic (internally and in ClinVar). The variant allele was found at a frequency of 5.7e-05 in 158744 control chromosomes (all heterozygotes). The variant has been reported in the literature in multiple individuals affected with Cartilage-Hair Hypoplasia (Harada_2005, Hermanns_2006, Turkkani-Asal_2009). These data indicate that the variant is likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function, and demonstrated that the variant resulted in severely reduced RMRP transcription (Hermanns_2005). Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014, and classified the variant as pathogenic (n=1) / likely pathogenic (n=1). Based on the evidence outlined above, the variant was classified as pathogenic.
ClinVar Genomic variation as it relates to human health
NR_003051.4(RMRP):n.-21_-2dup
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(7)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic/Likely pathogenic
7
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NR_003051.4(RMRP):n.-21_-2dup
Variation ID: 550387 Accession: VCV000550387.15
- Type and length
-
Duplication, 20 bp
- Location
-
Cytogenetic: 9p13.3 9: 35658020-35658021 (GRCh38) [ NCBI UCSC ] 9: 35658017-35658018 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 5, 2018 Oct 13, 2024 Jan 27, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNR_003051.4:n.-21_-2dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NC_000009.12:g.35658023_35658042dup NC_000009.11:g.35658020_35658039dup NG_017041.1:g.4979_4998dup NG_033120.1:g.4734_4753dup NG_116211.1:g.559_578dup LRG_163:g.4979_4998dup LRG_163t1:n.-22_-3dup - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000009.12:35658020:GTCCTCAGCTTCACAGAGTAGT:GTCCTCAGCTTCACAGAGTAGTCCTCAGCTTCACAGAGTAGT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| RMRP | - | - |
GRCh38 GRCh37 |
- | - | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic/Likely pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
Jan 25, 2024 | RCV000665120.13 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Jan 27, 2024 | RCV001240786.13 | |
| Pathogenic (1) |
criteria provided, single submitter
|
May 5, 2022 | RCV002493080.8 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Likely pathogenic
(Jan 20, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Metaphyseal chondrodysplasia, McKusick type
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000789186.1
First in ClinVar: Aug 05, 2018 Last updated: Aug 05, 2018 |
|
|
|
Pathogenic
(Apr 05, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Metaphyseal chondrodysplasia, McKusick type
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV001572342.1
First in ClinVar: Apr 30, 2021 Last updated: Apr 30, 2021 |
Comment:
Variant summary: RMRP n.-22_-3dup20 involves the duplication of 20 nucleotides in the promoter region of RMRP, which is located between the TATA box (-33 to … (more)
Variant summary: RMRP n.-22_-3dup20 involves the duplication of 20 nucleotides in the promoter region of RMRP, which is located between the TATA box (-33 to -25) and the transcription initiation site. Other insertions or duplications in the promoter region of RMRP have been classified as pathogenic (internally and in ClinVar). The variant allele was found at a frequency of 5.7e-05 in 158744 control chromosomes (all heterozygotes). The variant has been reported in the literature in multiple individuals affected with Cartilage-Hair Hypoplasia (Harada_2005, Hermanns_2006, Turkkani-Asal_2009). These data indicate that the variant is likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function, and demonstrated that the variant resulted in severely reduced RMRP transcription (Hermanns_2005). Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014, and classified the variant as pathogenic (n=1) / likely pathogenic (n=1). Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
|
Pathogenic
(May 05, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Metaphyseal chondrodysplasia, McKusick type
Metaphyseal dysplasia without hypotrichosis Anauxetic dysplasia 1
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002777835.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
|
Pathogenic
(Jan 27, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Anauxetic dysplasia
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001413758.5
First in ClinVar: Jul 16, 2020 Last updated: Feb 14, 2024 |
Comment:
This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in … (more)
This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in population databases (no rsID available, gnomAD 0.02%). This variant has been observed in individual(s) with cartilage-hair hypoplasia (CHH) (PMID: 15780958, 16838329). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as -4_-23dup, -5_-24dup, and -6_-25dup. ClinVar contains an entry for this variant (Variation ID: 550387). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RMRP function (PMID: 16254002). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Jan 25, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Metaphyseal chondrodysplasia, McKusick type
Affected status: yes
Allele origin:
germline
|
Laboratorio de Biologia Molecular/Medicina Genomica - IFF/Fiocruz, Instituto Fernandes Figueira, Fundacao Oswaldo Cruz
Accession: SCV004814085.1
First in ClinVar: Oct 13, 2024 Last updated: Oct 13, 2024 |
Comment:
The variant n.-21_-2dupTACTCTGTGAAGCTGAGGAC was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with … (more)
The variant n.-21_-2dupTACTCTGTGAAGCTGAGGAC was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with Cartilage-Hair Hypoplasia. This alteration is located within the promoter region of the RMRP gene, which encodes an untranslated RNA. Segregation analysis showed that each of the unaffected parents was heterozygous for one of the two variants. Other insertions and duplications in this region have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia spectrum disorders (PMID: 11207361, 21956908, 21396580). This variant involves the duplication of 20 nucleotides between the TATA box and the transcription initiation site and functional studies have shown that this type of alteration result in reduced expression of the RMRP gene (PMIDs: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic. (less)
Number of individuals with the variant: 1
Sex: male
Geographic origin: Brazil
|
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: research
|
Metaphyseal chondrodysplasia, McKusick type
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
inherited
|
Shenzhen Maternity and Child Healthcare Hospital, Institute of Maternal and Child Medicine Research
Accession: SCV005324796.1
First in ClinVar: Oct 08, 2024 Last updated: Oct 08, 2024 |
Sex: female
|
|
|
Pathogenic
(Sep 29, 2020)
|
no assertion criteria provided
Method: clinical testing
|
Cartilage-hair hypoplasia
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002075570.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
Comment:
Comment:
This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in population databases (no rsID available, gnomAD 0.02%). This variant has been observed in individual(s) with cartilage-hair hypoplasia (CHH) (PMID: 15780958, 16838329). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as -4_-23dup, -5_-24dup, and -6_-25dup. ClinVar contains an entry for this variant (Variation ID: 550387). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RMRP function (PMID: 16254002). For these reasons, this variant has been classified as Pathogenic.
Comment:
The variant n.-21_-2dupTACTCTGTGAAGCTGAGGAC was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with Cartilage-Hair Hypoplasia. This alteration is located within the promoter region of the RMRP gene, which encodes an untranslated RNA. Segregation analysis showed that each of the unaffected parents was heterozygous for one of the two variants. Other insertions and duplications in this region have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia spectrum disorders (PMID: 11207361, 21956908, 21396580). This variant involves the duplication of 20 nucleotides between the TATA box and the transcription initiation site and functional studies have shown that this type of alteration result in reduced expression of the RMRP gene (PMIDs: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
Variant summary: RMRP n.-22_-3dup20 involves the duplication of 20 nucleotides in the promoter region of RMRP, which is located between the TATA box (-33 to -25) and the transcription initiation site. Other insertions or duplications in the promoter region of RMRP have been classified as pathogenic (internally and in ClinVar). The variant allele was found at a frequency of 5.7e-05 in 158744 control chromosomes (all heterozygotes). The variant has been reported in the literature in multiple individuals affected with Cartilage-Hair Hypoplasia (Harada_2005, Hermanns_2006, Turkkani-Asal_2009). These data indicate that the variant is likely to be associated with disease. At least one publication reports experimental evidence evaluating an impact on protein function, and demonstrated that the variant resulted in severely reduced RMRP transcription (Hermanns_2005). Two clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014, and classified the variant as pathogenic (n=1) / likely pathogenic (n=1). Based on the evidence outlined above, the variant was classified as pathogenic.
Comment:
This variant occurs in the RMRP gene, which encodes an RNA molecule that does not result in a protein product. This variant is present in population databases (no rsID available, gnomAD 0.02%). This variant has been observed in individual(s) with cartilage-hair hypoplasia (CHH) (PMID: 15780958, 16838329). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is also known as -4_-23dup, -5_-24dup, and -6_-25dup. ClinVar contains an entry for this variant (Variation ID: 550387). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RMRP function (PMID: 16254002). For these reasons, this variant has been classified as Pathogenic.
Comment:
The variant n.-21_-2dupTACTCTGTGAAGCTGAGGAC was identified in a compound heterozygous state with another variant in the transcribed region of RMRP gene in an individual affected with Cartilage-Hair Hypoplasia. This alteration is located within the promoter region of the RMRP gene, which encodes an untranslated RNA. Segregation analysis showed that each of the unaffected parents was heterozygous for one of the two variants. Other insertions and duplications in this region have been reported in individuals affected with cartilage-hair hypoplasia-anauxetic dysplasia spectrum disorders (PMID: 11207361, 21956908, 21396580). This variant involves the duplication of 20 nucleotides between the TATA box and the transcription initiation site and functional studies have shown that this type of alteration result in reduced expression of the RMRP gene (PMIDs: 11207361, 16254002). For these reasons, this variant has been classified as Pathogenic.
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Identification of Novel and Recurrent RMRP Variants in a Series of Brazilian Patients with Cartilage-Hair Hypoplasia: McKusick Syndrome. | Gomes ME | Molecular syndromology | 2020 | PMID: 32021596 |
| Mild clinical phenotype and subtle radiographic findings in an infant with cartilage-hair hypoplasia. | Türkkani-Asal G | The Turkish journal of pediatrics | 2009 | PMID: 20112607 |
| Cartilage hair hypoplasia mutations that lead to RMRP promoter inefficiency or RNA transcript instability. | Nakashima E | American journal of medical genetics. Part A | 2007 | PMID: 17937437 |
| Type and level of RMRP functional impairment predicts phenotype in the cartilage hair hypoplasia-anauxetic dysplasia spectrum. | Thiel CT | American journal of human genetics | 2007 | PMID: 17701897 |
| RNase MRP RNA and human genetic diseases. | Martin AN | Cell research | 2007 | PMID: 17189938 |
| RMRP mutations in cartilage-hair hypoplasia. | Hermanns P | American journal of medical genetics. Part A | 2006 | PMID: 16838329 |
| Consequences of mutations in the non-coding RMRP RNA in cartilage-hair hypoplasia. | Hermanns P | Human molecular genetics | 2005 | PMID: 16254002 |
| An effective case of growth hormone treatment on cartilage-hair hypoplasia. | Harada D | Bone | 2005 | PMID: 15780958 |
| RMRP mutations in Japanese patients with cartilage-hair hypoplasia. | Nakashima E | American journal of medical genetics. Part A | 2003 | PMID: 14608646 |
| RMRP gene sequence analysis confirms a cartilage-hair hypoplasia variant with only skeletal manifestations and reveals a high density of single-nucleotide polymorphisms. | Bonafé L | Clinical genetics | 2002 | PMID: 11940090 |
| Mutations in the RNA component of RNase MRP cause a pleiotropic human disease, cartilage-hair hypoplasia. | Ridanpää M | Cell | 2001 | PMID: 11207361 |
| click to load more click to collapse | ||||
Text-mined citations for rs1554651411 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Oct 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.